ID: 1068786973

View in Genome Browser
Species Human (GRCh38)
Location 10:60987383-60987405
Sequence TGCCACTGATTTTAAGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068786973_1068786977 5 Left 1068786973 10:60987383-60987405 CCTGTTCCTTAAAATCAGTGGCA 0: 1
1: 0
2: 1
3: 20
4: 151
Right 1068786977 10:60987411-60987433 ACTCTCCCTGGTTCAACACTTGG No data
1068786973_1068786975 -7 Left 1068786973 10:60987383-60987405 CCTGTTCCTTAAAATCAGTGGCA 0: 1
1: 0
2: 1
3: 20
4: 151
Right 1068786975 10:60987399-60987421 AGTGGCACTGCCACTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068786973 Original CRISPR TGCCACTGATTTTAAGGAAC AGG (reversed) Intronic
904864106 1:33562936-33562958 TGCAATTTATTTTAAGGAACTGG - Intronic
906861929 1:49370239-49370261 TGAGATTGATTTTAAGGAACTGG + Intronic
908987302 1:70039427-70039449 TGCCATTCCTTTTCAGGAACTGG - Exonic
908998400 1:70187433-70187455 TGCCATTGAATTTGAGGAACAGG - Intronic
909966522 1:81918581-81918603 TGCCAGTGTTTGTAAGGCACAGG + Intronic
911271853 1:95811417-95811439 TGCCACTGAATTTAAGAACATGG - Intergenic
911924419 1:103810516-103810538 TGTTACTGGTTTTAAGTAACAGG + Intergenic
914314123 1:146493350-146493372 TGAGACTGATTTTAAGGAATTGG - Intergenic
914500225 1:148240032-148240054 TGAGACTGATTTTAAGGAATTGG + Intergenic
914701115 1:150135119-150135141 TCCCCCTGATTATAAGAAACTGG - Intronic
916567359 1:165992753-165992775 TCTCACTGATTTTAAGGACAAGG + Intergenic
916608038 1:166362453-166362475 TGCCACTGATAATAAGATACAGG - Intergenic
917160430 1:172051285-172051307 TGACAGTGAATATAAGGAACAGG - Intronic
918389732 1:184046348-184046370 TGAGATTGATTTTAAGGAATTGG - Intergenic
921664770 1:217855583-217855605 TGCCACTGAATACAATGAACTGG + Intronic
922183916 1:223257613-223257635 TGCCACTGATTTTGAATTACTGG - Intronic
923104070 1:230840910-230840932 TGCCACTGCATTTAAGAAACTGG - Intronic
1062825296 10:563398-563420 TTCTACTAATTTTAAGGAAGGGG - Intronic
1063022070 10:2139130-2139152 TGCAACTGATTTAAGGGAAATGG - Intergenic
1065715447 10:28562388-28562410 TGTCACTGCTCTTAAGAAACTGG - Intronic
1067269495 10:44777230-44777252 TGTAACTTATTTTAATGAACTGG - Intergenic
1067566561 10:47342980-47343002 TGCCACTAATGTGGAGGAACTGG + Intergenic
1067730764 10:48809754-48809776 TGCCTCTGATGTTTAGCAACTGG - Intronic
1068298709 10:55110671-55110693 TGTCTTTGCTTTTAAGGAACAGG - Intronic
1068786973 10:60987383-60987405 TGCCACTGATTTTAAGGAACAGG - Intronic
1069178567 10:65326517-65326539 TACCTTTTATTTTAAGGAACTGG + Intergenic
1069651037 10:70048987-70049009 TGTCACTGTTTTTAAGAACCAGG + Intergenic
1070969725 10:80553384-80553406 TCCCAGAGATTTTAAGGAACAGG + Intronic
1071078494 10:81782845-81782867 TACCAGTGTTTTTAAGAAACTGG + Intergenic
1079141618 11:17814443-17814465 TGCCATTGATTTGAAGGAATTGG - Intronic
1082645770 11:55722773-55722795 TGAGACTCATTTTATGGAACTGG + Intergenic
1082784984 11:57311721-57311743 TGCCTCTGAATTTAAGGGCCGGG - Intronic
1089252959 11:117178650-117178672 TGACACAGATTTAAAGGACCAGG - Intergenic
1090231522 11:125110283-125110305 TGCCACAGATATTAAGTAAATGG - Intronic
1096441495 12:51647388-51647410 TGCCTCTGATTCTCAAGAACTGG - Intronic
1097575823 12:61391138-61391160 TGCAACTGATTATAAGGAGAAGG - Intergenic
1098824349 12:75274617-75274639 TAGCACTGATTTTACAGAACAGG - Intergenic
1100330377 12:93575988-93576010 TGCCATTGATTTTTTGGAAATGG + Exonic
1102385749 12:112508125-112508147 AGCAACTGATCTTAAGCAACAGG - Exonic
1107356049 13:39568163-39568185 TGCAACTCATTTAAAGAAACAGG - Intronic
1107632592 13:42357000-42357022 TGCAGGTGATTTTAAGGAAGAGG - Intergenic
1107985183 13:45769716-45769738 TGCCACTGGTTGGGAGGAACGGG - Intergenic
1108120496 13:47180786-47180808 TGGCTCTGATTTTATGGACCAGG + Intergenic
1108697992 13:52919914-52919936 AGACACTGATTTCAAGGAACTGG - Intergenic
1110247857 13:73347397-73347419 TGTCAGGGATTTTAAGGAATAGG + Intergenic
1110466727 13:75810467-75810489 AGCCACTGATTTTAAAAACCAGG + Intronic
1111547296 13:89757464-89757486 TGCCACACATTTTATGAAACTGG + Intergenic
1111707475 13:91769038-91769060 AGCAACTTATTTTAAGGAATTGG + Intronic
1111925765 13:94461938-94461960 TGCCTGTGATTGTAAAGAACTGG - Intronic
1114523047 14:23350872-23350894 GGGTATTGATTTTAAGGAACTGG + Intronic
1115159886 14:30381919-30381941 TGCCCCAGATTTTAAGGTTCTGG + Intergenic
1116706770 14:48312508-48312530 TGGCACTGTTTTTAAGGTAGAGG - Intergenic
1117006801 14:51428814-51428836 TGCCATTCTTTTTAAGGACCAGG - Intergenic
1117321446 14:54627694-54627716 TCCCACTGGTTTAAAGGAGCAGG - Intronic
1119674614 14:76544484-76544506 TGCCACTGATTCTAGGTGACAGG + Intergenic
1122162975 14:99799937-99799959 TGCCACTGATTTTAAGTCCTTGG - Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1125076885 15:35630004-35630026 TGTCACTGACTTTCATGAACTGG - Intergenic
1125581666 15:40790034-40790056 TGCCACTAACTTCAAGGAAATGG + Intronic
1125696828 15:41645120-41645142 TGCAACTGATTTTAAGGCTAAGG - Intronic
1127614385 15:60669190-60669212 TGCCTCTGATTTTAATGAAATGG + Intronic
1128401774 15:67290174-67290196 TTCCACTGATTTTCAGGAGAAGG - Intronic
1130424692 15:83784269-83784291 TGCCACTGATTGGCAGGAATTGG + Intronic
1131871093 15:96765278-96765300 TGCCTCTGATTTTTAGAAACGGG - Intergenic
1133157704 16:3887371-3887393 TGCCAATGTGTTTAAGGAAAAGG - Intergenic
1140860017 16:79010341-79010363 TGCCACTGAGTTAAAGGCCCTGG - Intronic
1150874590 17:68955473-68955495 TGCCACTGCTCTGCAGGAACTGG - Intergenic
1152308611 17:79535786-79535808 TGCCACTTACTCCAAGGAACAGG + Intergenic
1153794714 18:8610783-8610805 TGCCCTTTATTTTAAAGAACGGG - Intronic
1153903700 18:9641527-9641549 AGGAACTGATTTTAAGGAATTGG + Intergenic
1161871439 19:6873416-6873438 AGAGAGTGATTTTAAGGAACTGG - Intergenic
1166582235 19:43911768-43911790 TGTCAGTGAAGTTAAGGAACTGG + Intergenic
1167851481 19:52205791-52205813 TGCCACAGATATTAAGGTACAGG - Intronic
925561692 2:5203093-5203115 TGAGAGAGATTTTAAGGAACTGG - Intergenic
927879848 2:26682588-26682610 ACCCAGTGATTTGAAGGAACAGG - Intergenic
928399591 2:30968310-30968332 TGCCACTGATCTTCACTAACTGG + Intronic
929336066 2:40747215-40747237 TGCCAGTGAAATTAAGGAAGAGG + Intergenic
934560603 2:95311381-95311403 TGCCTCTGACTTTAAGGAAAAGG + Intronic
936645987 2:114373642-114373664 TTCCACTGAATTTAATGAATTGG + Intergenic
939603118 2:144218804-144218826 TGTCACTGAGTATAAGGTACTGG + Intronic
941169152 2:162116638-162116660 TGCCACTGTTTTGAAAGAAGAGG + Intergenic
943770096 2:191706823-191706845 AGTCACTGATTTTAATAAACAGG + Intergenic
944275913 2:197837426-197837448 AGCCACTGATTTCAAGAAAACGG - Intronic
944582525 2:201144688-201144710 TGCCCCTGTGTTGAAGGAACAGG + Intronic
1169676750 20:8163283-8163305 AGTCACTGATTATTAGGAACTGG - Intronic
1169760705 20:9090115-9090137 GGCCAATGATTTTAAAAAACAGG - Intronic
1172209876 20:33189745-33189767 TGCCATTGATTTTTTGGAAATGG + Intergenic
1177071113 21:16509719-16509741 TGCCACTGACCATAAGAAACTGG + Intergenic
1177351770 21:19952217-19952239 TGCCAGAGATTTTAAGAAATCGG - Intergenic
1180676581 22:17590661-17590683 TAGCACTGATTTTGAGGAAAAGG + Exonic
1182648789 22:31833632-31833654 TGCCACTTATTTTAAGAAAACGG - Intronic
1182761208 22:32723726-32723748 AGCTAATGCTTTTAAGGAACTGG + Intronic
1184600429 22:45540139-45540161 GGCCACTGATTTAAGGGAGCTGG + Intronic
949310966 3:2697725-2697747 AGATACTTATTTTAAGGAACTGG + Intronic
951040139 3:17980996-17981018 TGCAACTGATTTTAATGCAAGGG - Intronic
955746868 3:62149051-62149073 AGTAAATGATTTTAAGGAACAGG - Intronic
963714650 3:148789109-148789131 AGCAACTGATTTTAAGGGTCTGG + Intergenic
966215525 3:177498305-177498327 TGCTACTGATTTGAAGAAAGTGG + Intergenic
969205665 4:5643216-5643238 TCCCTCTGCTTTTAAGAAACAGG - Intronic
971199098 4:24495710-24495732 AAACATTGATTTTAAGGAACTGG + Intergenic
971569693 4:28195502-28195524 TGCAAAGGATTTTAAGTAACTGG - Intergenic
971742260 4:30535712-30535734 TGACACTCATTTTAAGGATATGG - Intergenic
974718176 4:65698855-65698877 TGCCACTGAGTGAAAGGAAAAGG + Intergenic
974746567 4:66085658-66085680 TCCCACTGATTTGAATGAAAAGG + Intergenic
974749700 4:66121160-66121182 TGGTACTTATTCTAAGGAACTGG - Intergenic
974823971 4:67103267-67103289 TGCCACTGATATTTTTGAACCGG - Intergenic
977444722 4:97116355-97116377 CTCCACAGGTTTTAAGGAACTGG + Intergenic
978081037 4:104591879-104591901 TGCCACTGCTTCTAGGCAACAGG - Intergenic
979523254 4:121692166-121692188 TGCATTTGATTTTAAGAAACAGG - Intronic
980978351 4:139632741-139632763 TAACAGTGATTTTAGGGAACAGG + Intergenic
982110988 4:152053948-152053970 TGGCACTGACTTTGAGGAACTGG - Intergenic
984157167 4:176207162-176207184 TACCTCTGGTTTTTAGGAACTGG + Intergenic
984460496 4:180030398-180030420 TGCCACAGATTTTAAGGAATTGG - Intergenic
984623592 4:181980169-181980191 TGCCTCTGACATTAGGGAACTGG - Intergenic
987847096 5:23301236-23301258 AGCAACTGATCTTAAGCAACAGG + Intergenic
988570217 5:32357858-32357880 TTCCACTGATTTGAAGCATCAGG + Intronic
989577919 5:43006247-43006269 TGCCACTGAGTTTACTGAAAAGG + Intergenic
989726305 5:44590710-44590732 TGCCAGTGATTGTAAGTAAGAGG - Intergenic
994078054 5:95675520-95675542 GGCCACTGATTTGGAGGATCTGG + Exonic
995590507 5:113694847-113694869 TGCCACTGAATCTAGGCAACTGG + Intergenic
995919963 5:117299911-117299933 TGACACTTATTTGAAGGAAGGGG - Intergenic
996243797 5:121235044-121235066 TTCTATTGATTTTAAGTAACAGG - Intergenic
998880904 5:146643718-146643740 TTCCACAGGTTTTAAGGAACAGG - Intronic
999544066 5:152607307-152607329 TGTCATTGACTTTAAGGAAAGGG + Intergenic
1000990002 5:167902117-167902139 TGCAACAGATTTTTAGGAGCAGG + Intronic
1003144926 6:3502104-3502126 TGTCACTGGTTTTCAGAAACTGG + Intergenic
1003169009 6:3705737-3705759 TTCCACTGAATTAAAGGAACTGG + Intergenic
1008457334 6:51726237-51726259 TGCCCCTGAGTTAATGGAACCGG - Intronic
1010099123 6:72082159-72082181 TGGCACTGCTTTTAAGAATCTGG + Intronic
1010348991 6:74849317-74849339 TGCTACAGATTTTAAGAAAAGGG + Intergenic
1010686209 6:78857686-78857708 GGCCACTGATAATGAGGAACAGG - Intergenic
1011403012 6:86984792-86984814 GGCCACAGTTTTTAAGAAACAGG - Intronic
1013043573 6:106461143-106461165 TGCCTCTGATTTAAAGCATCAGG + Intergenic
1015148295 6:130012110-130012132 TGGCACTGATGTAAAGGAATGGG + Intergenic
1015744102 6:136491329-136491351 TGCCAATGATTTTAAGTGCCAGG + Intronic
1020885647 7:13816276-13816298 TGAGATTTATTTTAAGGAACTGG + Intergenic
1022454299 7:30545166-30545188 GGCCACTGATATTGAGAAACAGG - Intronic
1027795295 7:82685492-82685514 TGCCACTTATTTTAAAGCTCAGG + Intergenic
1031528158 7:122846625-122846647 AGCCAATAATTTTAAGGAAGAGG + Intronic
1033483559 7:141765193-141765215 TCCTACTGATGTTATGGAACTGG - Exonic
1036920119 8:12844380-12844402 TGCCAATGATGTTTAGGAATAGG - Intergenic
1039372284 8:36997578-36997600 TGCCACTGCATTTAAGTGACAGG + Intergenic
1041489888 8:58421932-58421954 AGCAACTGATCTTAAGCAACGGG + Intronic
1046890710 8:119417821-119417843 TGCCACTCATTTTATGGATGAGG - Intronic
1049062143 8:140285044-140285066 TGGCAGTTATTTTAAGCAACAGG - Intronic
1049764145 8:144345540-144345562 TGCCACTGATTTTAGGTATTTGG - Intergenic
1049802335 8:144523694-144523716 TGCCACTGTTTTTAGGAACCTGG + Exonic
1050451944 9:5791206-5791228 TGAGATTTATTTTAAGGAACTGG + Intronic
1051283340 9:15466541-15466563 TGCCACTGAATTCAAGGGAATGG - Intronic
1053456165 9:38234566-38234588 TGATCCTGATTTTAAGGAAAAGG + Intergenic
1054855538 9:69895318-69895340 AGAGACTGATTTTAAGGAATTGG - Intronic
1054977471 9:71164618-71164640 TGTCAGTGATTTTAAGGAGAAGG + Intronic
1055870557 9:80873562-80873584 TGCCACTGATTAGAAAGAATAGG + Intergenic
1056675607 9:88674566-88674588 TGCCACTGATTTTTTGCTACTGG + Intergenic
1057894440 9:98896263-98896285 AGCCAATTATTTTAAAGAACAGG + Intergenic
1058191277 9:101919087-101919109 TGCCACTGTTTTTAATGTACAGG - Intergenic
1058539078 9:105993250-105993272 TCCCATTGAATTTAAAGAACGGG - Intergenic
1061388615 9:130304893-130304915 TGCCACTGATCTCCAGGGACAGG - Intronic
1186298865 X:8177450-8177472 TGCCCCTAATTGTAAGGCACAGG + Intergenic
1187360628 X:18624122-18624144 TCCCAGTGAATTTATGGAACTGG - Intronic
1187548003 X:20271160-20271182 TGACACAGATCTTAAAGAACAGG + Intergenic
1190989518 X:55531835-55531857 TGGCAAGGATTTGAAGGAACTGG - Intergenic
1197402286 X:126006553-126006575 TGCCTCTGATTGTAGTGAACAGG - Intergenic
1197866375 X:131023012-131023034 TATCACTGATTTTAAGCAATTGG + Intergenic
1198062381 X:133059813-133059835 TGTCAGTGATTTTAAGGAAGAGG - Intronic
1199041283 X:143118104-143118126 TGCCACTGATTTTTGGGGACAGG - Intergenic
1199560489 X:149158131-149158153 TGCTAGTTATTTTAAGGAATTGG - Intergenic
1201439615 Y:13993723-13993745 TGCCGCTAATTGTAAGGCACAGG + Intergenic
1201444958 Y:14048985-14049007 TGCCCCTAATTGTAAGGCACAGG - Intergenic
1202171612 Y:22051912-22051934 TGCCACTGATCTTCAGAAAGCGG - Intergenic
1202219750 Y:22534460-22534482 TGCCACTGATCTTCAGAAAGCGG + Intergenic
1202323427 Y:23661623-23661645 TGCCACTGATCTTCAGAAAGCGG - Intergenic
1202547344 Y:26008431-26008453 TGCCACTGATCTTCAGAAAGCGG + Intergenic