ID: 1068787215

View in Genome Browser
Species Human (GRCh38)
Location 10:60989696-60989718
Sequence GTGCTGAAGCAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068787207_1068787215 14 Left 1068787207 10:60989659-60989681 CCACTTTGCCCCTACTCTGGGTA 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG No data
1068787209_1068787215 6 Left 1068787209 10:60989667-60989689 CCCCTACTCTGGGTAGGTTTCCA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG No data
1068787210_1068787215 5 Left 1068787210 10:60989668-60989690 CCCTACTCTGGGTAGGTTTCCAA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG No data
1068787211_1068787215 4 Left 1068787211 10:60989669-60989691 CCTACTCTGGGTAGGTTTCCAAC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068787215 Original CRISPR GTGCTGAAGCAGAAGCAGGA AGG Intronic
No off target data available for this crispr