ID: 1068788826

View in Genome Browser
Species Human (GRCh38)
Location 10:61005507-61005529
Sequence CTGGTCCTGGACTGTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068788819_1068788826 22 Left 1068788819 10:61005462-61005484 CCAGCTATTCTTTGTACCTCTGG 0: 11
1: 261
2: 2929
3: 4895
4: 6787
Right 1068788826 10:61005507-61005529 CTGGTCCTGGACTGTTTTGTTGG No data
1068788822_1068788826 6 Left 1068788822 10:61005478-61005500 CCTCTGGTAGAATTCGGCTATGA 0: 111
1: 5543
2: 5450
3: 2340
4: 888
Right 1068788826 10:61005507-61005529 CTGGTCCTGGACTGTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068788826 Original CRISPR CTGGTCCTGGACTGTTTTGT TGG Intergenic
No off target data available for this crispr