ID: 1068789459

View in Genome Browser
Species Human (GRCh38)
Location 10:61011094-61011116
Sequence AAGGTAGTCACTTGCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068789451_1068789459 29 Left 1068789451 10:61011042-61011064 CCCTCTCTTCATATGCATACACT No data
Right 1068789459 10:61011094-61011116 AAGGTAGTCACTTGCAAGCCAGG No data
1068789452_1068789459 28 Left 1068789452 10:61011043-61011065 CCTCTCTTCATATGCATACACTG No data
Right 1068789459 10:61011094-61011116 AAGGTAGTCACTTGCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068789459 Original CRISPR AAGGTAGTCACTTGCAAGCC AGG Intergenic
No off target data available for this crispr