ID: 1068791833

View in Genome Browser
Species Human (GRCh38)
Location 10:61037720-61037742
Sequence CTTAAAAACCCTATTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068791833_1068791836 -4 Left 1068791833 10:61037720-61037742 CCAAGTTCAATAGGGTTTTTAAG No data
Right 1068791836 10:61037739-61037761 TAAGTTTCGCTCTGGGCCTAAGG No data
1068791833_1068791837 -1 Left 1068791833 10:61037720-61037742 CCAAGTTCAATAGGGTTTTTAAG No data
Right 1068791837 10:61037742-61037764 GTTTCGCTCTGGGCCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068791833 Original CRISPR CTTAAAAACCCTATTGAACT TGG (reversed) Intergenic
No off target data available for this crispr