ID: 1068792993

View in Genome Browser
Species Human (GRCh38)
Location 10:61047802-61047824
Sequence CTCTGTGACCAATAGTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068792993_1068792996 10 Left 1068792993 10:61047802-61047824 CCAACTTACTATTGGTCACAGAG No data
Right 1068792996 10:61047835-61047857 CCAGAGCTGGAAGAGACAACAGG No data
1068792993_1068792997 11 Left 1068792993 10:61047802-61047824 CCAACTTACTATTGGTCACAGAG No data
Right 1068792997 10:61047836-61047858 CAGAGCTGGAAGAGACAACAGGG No data
1068792993_1068792998 12 Left 1068792993 10:61047802-61047824 CCAACTTACTATTGGTCACAGAG No data
Right 1068792998 10:61047837-61047859 AGAGCTGGAAGAGACAACAGGGG No data
1068792993_1068792994 -3 Left 1068792993 10:61047802-61047824 CCAACTTACTATTGGTCACAGAG No data
Right 1068792994 10:61047822-61047844 GAGTCACAAAACACCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068792993 Original CRISPR CTCTGTGACCAATAGTAAGT TGG (reversed) Intergenic
No off target data available for this crispr