ID: 1068794398

View in Genome Browser
Species Human (GRCh38)
Location 10:61062433-61062455
Sequence CCACTCCCCCATCCAACGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068794398_1068794401 -8 Left 1068794398 10:61062433-61062455 CCTGTCGTTGGATGGGGGAGTGG No data
Right 1068794401 10:61062448-61062470 GGGAGTGGGTGATTGTAAGATGG No data
1068794398_1068794402 -7 Left 1068794398 10:61062433-61062455 CCTGTCGTTGGATGGGGGAGTGG No data
Right 1068794402 10:61062449-61062471 GGAGTGGGTGATTGTAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068794398 Original CRISPR CCACTCCCCCATCCAACGAC AGG (reversed) Intergenic
No off target data available for this crispr