ID: 1068796638

View in Genome Browser
Species Human (GRCh38)
Location 10:61089493-61089515
Sequence TATCCTTTCCCCTGGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068796638_1068796644 8 Left 1068796638 10:61089493-61089515 CCCAACCCCCAGGGGAAAGGATA No data
Right 1068796644 10:61089524-61089546 TCACTTCAGAGTGCTCTGCCTGG No data
1068796638_1068796645 9 Left 1068796638 10:61089493-61089515 CCCAACCCCCAGGGGAAAGGATA No data
Right 1068796645 10:61089525-61089547 CACTTCAGAGTGCTCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068796638 Original CRISPR TATCCTTTCCCCTGGGGGTT GGG (reversed) Intergenic
No off target data available for this crispr