ID: 1068799009

View in Genome Browser
Species Human (GRCh38)
Location 10:61118274-61118296
Sequence GATTGTGAATGGAGTAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068799009_1068799012 -7 Left 1068799009 10:61118274-61118296 CCACCTCTACTCCATTCACAATC No data
Right 1068799012 10:61118290-61118312 CACAATCTCTGCTTGCACCAAGG No data
1068799009_1068799014 6 Left 1068799009 10:61118274-61118296 CCACCTCTACTCCATTCACAATC No data
Right 1068799014 10:61118303-61118325 TGCACCAAGGTGTTAGCTCAGGG No data
1068799009_1068799013 5 Left 1068799009 10:61118274-61118296 CCACCTCTACTCCATTCACAATC No data
Right 1068799013 10:61118302-61118324 TTGCACCAAGGTGTTAGCTCAGG No data
1068799009_1068799016 16 Left 1068799009 10:61118274-61118296 CCACCTCTACTCCATTCACAATC No data
Right 1068799016 10:61118313-61118335 TGTTAGCTCAGGGTTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068799009 Original CRISPR GATTGTGAATGGAGTAGAGG TGG (reversed) Intergenic
No off target data available for this crispr