ID: 1068813304

View in Genome Browser
Species Human (GRCh38)
Location 10:61281016-61281038
Sequence CTAGTTAGACATTTCTGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068813302_1068813304 1 Left 1068813302 10:61280992-61281014 CCCAGAAAGGAAATGCAAGCACT No data
Right 1068813304 10:61281016-61281038 CTAGTTAGACATTTCTGATAAGG No data
1068813299_1068813304 24 Left 1068813299 10:61280969-61280991 CCACCAGTGGGAACTGAGATTGT No data
Right 1068813304 10:61281016-61281038 CTAGTTAGACATTTCTGATAAGG No data
1068813303_1068813304 0 Left 1068813303 10:61280993-61281015 CCAGAAAGGAAATGCAAGCACTG No data
Right 1068813304 10:61281016-61281038 CTAGTTAGACATTTCTGATAAGG No data
1068813300_1068813304 21 Left 1068813300 10:61280972-61280994 CCAGTGGGAACTGAGATTGTCCC No data
Right 1068813304 10:61281016-61281038 CTAGTTAGACATTTCTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068813304 Original CRISPR CTAGTTAGACATTTCTGATA AGG Intergenic
No off target data available for this crispr