ID: 1068822674

View in Genome Browser
Species Human (GRCh38)
Location 10:61395804-61395826
Sequence CTGCACATTCACATGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068822674_1068822678 1 Left 1068822674 10:61395804-61395826 CCCTTGTGCATGTGAATGTGCAG No data
Right 1068822678 10:61395828-61395850 GCGACACAGAGCAATAGCATTGG No data
1068822674_1068822679 7 Left 1068822674 10:61395804-61395826 CCCTTGTGCATGTGAATGTGCAG No data
Right 1068822679 10:61395834-61395856 CAGAGCAATAGCATTGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068822674 Original CRISPR CTGCACATTCACATGCACAA GGG (reversed) Intergenic
No off target data available for this crispr