ID: 1068823860

View in Genome Browser
Species Human (GRCh38)
Location 10:61410893-61410915
Sequence TCCACCCTGAATTAAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068823860 Original CRISPR TCCACCCTGAATTAAATTAC TGG (reversed) Intronic
901935033 1:12620926-12620948 TCTGCCCTGAGTTAAATTCCAGG - Intergenic
904990142 1:34585942-34585964 TCAGCCCTGAATTACATTTCTGG + Intergenic
905776163 1:40668578-40668600 TCGACACTGAAATAAATTCCAGG + Intergenic
909218499 1:72923457-72923479 TACTCCCTGTATTACATTACTGG - Intergenic
919163349 1:193860505-193860527 TCTGCCCAGAAATAAATTACTGG - Intergenic
920155373 1:203945758-203945780 CCCAGCCTTAATTAAAATACAGG - Intergenic
922110481 1:222550372-222550394 TCCACCTTGAATTTCCTTACTGG + Intergenic
923534121 1:234835481-234835503 TTCTCCCTGAATTAGATTATTGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063474677 10:6318081-6318103 TCCACCCTAAATTCAGTTCCCGG + Intergenic
1065698704 10:28403916-28403938 TCCAGCCTTAATTAATTTTCTGG + Intergenic
1068263089 10:54608716-54608738 TTCACATTGAATTAAATTAAGGG + Intronic
1068823860 10:61410893-61410915 TCCACCCTGAATTAAATTACTGG - Intronic
1070498935 10:77052280-77052302 TCTACCCAGAGTTAACTTACTGG - Intronic
1071472689 10:85995259-85995281 TCTACCCAGAAATAAAATACAGG - Intronic
1078704783 11:13732508-13732530 TCCCCCTTGTATAAAATTACAGG - Intergenic
1088627975 11:111746107-111746129 TCCACAAAGAATTAAATTCCTGG - Intronic
1089426654 11:118382483-118382505 TCCACCCTAAACCATATTACAGG - Intronic
1097835427 12:64268199-64268221 TACCCCCTAAATTACATTACTGG - Intronic
1102410589 12:112714663-112714685 TCTGCCCTGAATTAATTTAAAGG - Intronic
1105931980 13:25061239-25061261 TCCTCCTTGAATTAAATGAAAGG + Intergenic
1107634662 13:42380251-42380273 CCTACCCTCAATTAATTTACTGG + Intergenic
1113025613 13:105937834-105937856 TCCAGGCTGAATTACATTAGAGG - Intergenic
1117100867 14:52345482-52345504 TACAACCTGATTTTAATTACGGG - Intergenic
1117910738 14:60636596-60636618 TTCTTCCGGAATTAAATTACTGG + Intergenic
1118875391 14:69780199-69780221 TCTACTCTGAATGAAATTATAGG + Intronic
1119272064 14:73315645-73315667 TCCAATCTAAATTAAATTTCAGG - Intronic
1121875220 14:97445313-97445335 TCCACCTTGACTTAAATTAAAGG + Intergenic
1130775271 15:86972900-86972922 TTCACCCAGAATCAAATTTCTGG + Intronic
1134372878 16:13641856-13641878 TCAACCCTGATTTAGATTAATGG + Intergenic
1134852075 16:17487829-17487851 TCAACCCAGACTTAAATTCCTGG - Intergenic
1136751612 16:32641354-32641376 TATACCCAGAATTAAATTGCTGG + Intergenic
1139928943 16:70509657-70509679 TTAACCCTAAAATAAATTACTGG - Intronic
1140213565 16:72989778-72989800 TCCACCCTGCATGAATTTCCAGG + Intronic
1141775004 16:86117274-86117296 TCCACCCTGTATTCATTTCCTGG + Intergenic
1203053747 16_KI270728v1_random:900609-900631 TATACCCAGAATTAAATTGCTGG + Intergenic
1147019245 17:37518019-37518041 TTCACCCTGAATTAATTTTCAGG + Exonic
1149078007 17:52619598-52619620 GCCACTCTGAATTAAATTCAAGG - Intergenic
1151027238 17:70692358-70692380 TCCTCCCAGAACTAAATTTCAGG + Intergenic
1161357894 19:3829405-3829427 TCCACCCTGAAATGATTTAGCGG - Intronic
928981533 2:37140530-37140552 TAGACCCTGAATTAAATAGCTGG + Intronic
929713274 2:44286329-44286351 TCAAGCCTGAATTAAATCCCAGG + Intronic
929864497 2:45706696-45706718 CCCACAATGAATTAAATTTCAGG + Intronic
939050486 2:137301423-137301445 TTCACCATGATATAAATTACAGG - Intronic
939849692 2:147289842-147289864 TCCCAGCTGAATTAAATTCCAGG + Intergenic
945369600 2:209000534-209000556 TCCATCCTAAAGTAAATGACAGG - Intergenic
948955475 2:241287003-241287025 TTCACCCTGTATCAAATGACTGG + Intronic
1170747032 20:19108895-19108917 TCAAGACTGAATTAAAATACTGG - Intergenic
1174974915 20:55321142-55321164 TCCAACTTATATTAAATTACAGG - Intergenic
1177526846 21:22304311-22304333 TCAACCCAGAATTCCATTACTGG + Intergenic
1177670935 21:24226204-24226226 TCCACCTTGTCATAAATTACAGG + Intergenic
1178342064 21:31794119-31794141 TCCAACCAGAATTAAACAACTGG - Intergenic
1180110375 21:45644551-45644573 GCCACTCTGAAGTATATTACTGG + Intronic
952086701 3:29831113-29831135 TCCACCCTGAGTAAAGTTTCAGG - Intronic
954768675 3:52945392-52945414 TCCACACTGATATAAATTAGGGG + Intronic
965914183 3:173820948-173820970 TCTATCTTGAATTGAATTACAGG + Intronic
966199343 3:177345466-177345488 TTCACACTGAATAATATTACAGG - Intergenic
970485585 4:16521423-16521445 TGCACCCTAAATCTAATTACTGG - Intronic
976525274 4:86080201-86080223 TCCAACCTTTATTCAATTACTGG - Intronic
977312218 4:95401605-95401627 CCCAATCTGTATTAAATTACTGG - Intronic
982874737 4:160632851-160632873 CCCAGACTGAATTACATTACAGG - Intergenic
985049051 4:185971544-185971566 TCCAGGCTGCATAAAATTACAGG + Intergenic
987552284 5:19399141-19399163 TCATACATGAATTAAATTACTGG - Intergenic
990002815 5:50914421-50914443 TCCATCATGAATTAACTTAGGGG - Intergenic
990606366 5:57414474-57414496 TCCACACTGATTTAACCTACTGG + Intergenic
992891579 5:81209140-81209162 TTCAGCCTGAATTACATTCCAGG + Intronic
996361421 5:122651452-122651474 TACACACAGAATTAAAGTACTGG + Intergenic
999038562 5:148381940-148381962 TCCACTATGAATTCAAATACAGG - Intergenic
1001993961 5:176140141-176140163 TATACCCAGAATTAAATTGCTGG + Intergenic
1002564584 5:180102970-180102992 TCCTCCCAGAATTTAAGTACAGG - Intronic
1007975769 6:46099734-46099756 TCCACCCTTAATTAAATAGGTGG - Intergenic
1008431763 6:51426388-51426410 TCTATCTTGAATTAAATTAGAGG + Intergenic
1016585811 6:145683706-145683728 CCCACCCTGAATGAAAAGACAGG - Intronic
1017372906 6:153734814-153734836 TACAAACTGAATTAAATTATTGG + Intergenic
1020574266 7:9905626-9905648 TCCATCCTGAAATCAATCACTGG + Intergenic
1020592579 7:10159847-10159869 TCCAACCTCAAGTAAATTTCTGG - Intergenic
1021267084 7:18538135-18538157 TTCACCCTGAATTCATTTTCTGG + Intronic
1022967869 7:35490419-35490441 TCCCCCATGAATAAAGTTACTGG + Intergenic
1023029555 7:36080401-36080423 TCCACCCTAAATCCAATGACTGG - Intronic
1036214706 8:6869448-6869470 GCAACCCTGAATGAAATTATAGG - Intergenic
1040405123 8:47093752-47093774 TCCACCTTGAATTAATTTTTGGG - Intergenic
1042389315 8:68214821-68214843 TCAACCATGAATCAAATTACAGG + Intronic
1043103386 8:76076498-76076520 TCCATCCTGAAAAAAATTTCTGG - Intergenic
1045420442 8:102009395-102009417 TCTACCCTGAATAAAATGGCAGG - Intronic
1045614253 8:103888989-103889011 TCCTCACTGAATTCAATTATTGG - Intronic
1046876945 8:119265686-119265708 TGCACCCTGATTTAAATTTCTGG - Intergenic
1046994740 8:120505321-120505343 TTCACCCAGCACTAAATTACAGG + Intronic
1052806325 9:33017124-33017146 TCCACACTGAATTAAATTGTAGG - Intronic
1055048824 9:71959076-71959098 TCCACTCTGAATTCAAATTCTGG - Intronic
1055849266 9:80606087-80606109 TTCAATATGAATTAAATTACTGG + Intergenic
1059820260 9:117964819-117964841 CACACCCTGAATTAAACCACAGG + Intergenic
1059862359 9:118478908-118478930 TCAACCCTGAAGTAAAATAAAGG - Intergenic
1061401410 9:130370383-130370405 TCCACCCTGAATTATCCTTCAGG - Intronic
1062226505 9:135455445-135455467 TCCACCCAGACTCAAATGACGGG - Intergenic
1194639065 X:96380881-96380903 TCAATCCTGATTTAAATTTCTGG - Intergenic
1195731179 X:107969057-107969079 TCCCACCTAAATTGAATTACTGG - Intergenic
1200875462 Y:8149828-8149850 TCCACCCTCCAAAAAATTACTGG - Intergenic