ID: 1068824157

View in Genome Browser
Species Human (GRCh38)
Location 10:61414466-61414488
Sequence TTTAAATGCTTCAAGTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068824154_1068824157 9 Left 1068824154 10:61414434-61414456 CCAAAAGAAATGAGGTGATTGTA 0: 1
1: 0
2: 0
3: 22
4: 347
Right 1068824157 10:61414466-61414488 TTTAAATGCTTCAAGTGTAGAGG 0: 1
1: 0
2: 0
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068824157 Original CRISPR TTTAAATGCTTCAAGTGTAG AGG Intronic
900871180 1:5304482-5304504 TTTAAATACTTCAAGAGCAGTGG - Intergenic
902335265 1:15750942-15750964 TTTAAACTCTTCAAGTTTGGGGG - Intergenic
904731644 1:32596866-32596888 TATAAATGCTTTAAGTGTCTAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
904922972 1:34023121-34023143 TTTAAATCCTTCGAGTGTGGTGG - Intronic
908056880 1:60297365-60297387 TTTAAATGACTCAGGTGGAGAGG - Intergenic
909194699 1:72602888-72602910 TATAAAAGCTTCAAGTTGAGAGG - Intergenic
909970835 1:81986791-81986813 TTTATATTCATCAAGGGTAGTGG - Intronic
911444646 1:97976028-97976050 TTTAAATTCTTTAATTGTAAAGG - Intergenic
911656154 1:100446358-100446380 TATAAATGCTTCTAGTGATGAGG + Intronic
917079637 1:171243896-171243918 CTTTGATGCTTCGAGTGTAGCGG + Intergenic
918539324 1:185611559-185611581 TTTAAATGCTGCAAGAGAAAAGG - Intergenic
919328240 1:196136700-196136722 TTTAAATGCAGCAAAAGTAGTGG - Intergenic
919439049 1:197604344-197604366 TTTAAATACCTTAAGAGTAGCGG + Intronic
921597330 1:217068879-217068901 TTTAAATGCTGGACGTGGAGGGG - Intronic
924469574 1:244329569-244329591 TTTACATGCTTCAATTGTTGGGG + Intergenic
1064085563 10:12343823-12343845 TTTAAATTAGCCAAGTGTAGTGG - Intergenic
1065369194 10:24965802-24965824 TTTAAATGCAGCAAGTTTATAGG - Intergenic
1066333694 10:34453879-34453901 GTAAAATTCTTCAAGTGCAGTGG - Intronic
1066571961 10:36783470-36783492 TTTAAATTCTTCAAATGTATTGG - Intergenic
1068824157 10:61414466-61414488 TTTAAATGCTTCAAGTGTAGAGG + Intronic
1069141467 10:64832039-64832061 TTTAAATGCTAAAATTGAAGAGG + Intergenic
1069395957 10:67988107-67988129 TTGAACTGCTACAAGTGTAAAGG + Intronic
1070480839 10:76881363-76881385 TGTAAGTGCTTCAAGGGTACTGG - Intronic
1071271544 10:84012002-84012024 TTTAGAATCTTCAAGTGAAGTGG - Intergenic
1071445240 10:85740099-85740121 TTTAATTGTTTCAGGTGTATTGG + Intronic
1071712888 10:88067045-88067067 TTTGAGCGCTTCATGTGTAGCGG + Intergenic
1072185909 10:93038801-93038823 TTTGAGTTCTTCAAGGGTAGAGG - Intronic
1073589293 10:104741112-104741134 TTTAAATTATCCAGGTGTAGTGG - Intronic
1073838850 10:107475301-107475323 TTTAAATGCTTAGAATGTTGGGG + Intergenic
1075157776 10:119993328-119993350 TTTAAATGAGCCAAGTGTGGTGG - Intergenic
1078975456 11:16469964-16469986 TTTAAAAGCTTAAAATGTAATGG + Intronic
1079219342 11:18546065-18546087 TTTAAATGTTCCCAATGTAGAGG - Intronic
1080475892 11:32590773-32590795 TAAAAATGCTTCAAGTTTATGGG + Intronic
1081104212 11:39044659-39044681 TTGAAATGATTGAAATGTAGAGG - Intergenic
1084292337 11:68182070-68182092 TTTAGATGCTTCAATTCTATGGG + Intronic
1084570149 11:69954685-69954707 TTTAGATTCTGCAAGAGTAGTGG + Intergenic
1086041613 11:82486274-82486296 TTAAAATGCTTTAAGTGTAAGGG + Intergenic
1086335519 11:85797036-85797058 TTTAAATGATCCAGGTGCAGTGG + Intronic
1086861349 11:91928054-91928076 TTTAGTTGCTTCATGTGTAAAGG + Intergenic
1086965567 11:93024359-93024381 TCCAAAAGCTTCAAGTGCAGGGG + Intergenic
1087509318 11:99069944-99069966 TTTAACTTCCTCAGGTGTAGGGG + Intronic
1087523019 11:99267612-99267634 TTTAAATGTTTTAATTGTTGGGG - Intronic
1088993800 11:114978342-114978364 TTTAACTGCTTCAAGAGTTAAGG + Intergenic
1093054655 12:14543926-14543948 TTTAAATTATCCAAGAGTAGGGG - Intronic
1096276980 12:50217866-50217888 TTGAAATGCTTGAAATGTAGAGG - Intronic
1099021907 12:77416798-77416820 TTGAAAGGCTTCAAATGTTGAGG - Intergenic
1099363435 12:81736893-81736915 TTTAAATGAGCCAAGTGTGGTGG - Intronic
1099431670 12:82593509-82593531 TTTAAATGATTGGAGAGTAGTGG + Intergenic
1099983760 12:89638944-89638966 TTTAAACTCTTCAAGTATTGAGG - Intronic
1101864370 12:108509322-108509344 TAAAAATGCTTTAAGGGTAGGGG - Intergenic
1103310365 12:120001899-120001921 TTTAAATTCTCCATGTGTAGTGG + Intronic
1106156657 13:27164243-27164265 CTGAAATGCTTCATGGGTAGAGG - Intronic
1107198623 13:37685671-37685693 TTTAGATGGTTCAAGGGAAGAGG - Intronic
1108759935 13:53550994-53551016 TTTAAATGCTTCAAGATAAGTGG + Intergenic
1109247486 13:59973819-59973841 TCTAAATGTTTTATGTGTAGAGG + Intronic
1111662344 13:91226877-91226899 TTTATAAGCTTCAAGTTTCGTGG - Intergenic
1111697624 13:91644963-91644985 TTTAAATGATTGAAGTTCAGTGG + Intronic
1111876100 13:93898102-93898124 CATAATTGCTTCAATTGTAGAGG - Intronic
1114353188 14:21877410-21877432 ATTAAATGATTGAATTGTAGTGG + Intergenic
1116421799 14:44741871-44741893 TATTAATGCTTAAAGTTTAGAGG - Intergenic
1116601056 14:46923262-46923284 TTTAAATGCTTTATCTGTATTGG + Intronic
1117670094 14:58097883-58097905 TTTCAATGCTCCAAGTGGAGTGG + Intronic
1118541425 14:66831401-66831423 TTTAAATACTTCAGGTATAAGGG - Intronic
1118712168 14:68529123-68529145 TAAAATTGCTTCAAGTGCAGTGG + Intronic
1120069611 14:80088509-80088531 TTTAAATGCTTTATGTGGAGGGG + Intergenic
1120627185 14:86842679-86842701 TTTAGTTGCTGCAAGTTTAGTGG + Intergenic
1121447024 14:93985363-93985385 TTTACATTCTTTAAGTGAAGAGG + Intergenic
1124852033 15:33349192-33349214 TTTAATTGCTTCCAGTTTTGGGG + Intronic
1128824419 15:70698781-70698803 TTTAAATGCTATAAGTATAGAGG + Intronic
1131612737 15:93982054-93982076 TTCAAATGCTTCCAGAGAAGGGG - Intergenic
1133747818 16:8700746-8700768 TTAAAATGCGCCAGGTGTAGTGG - Intronic
1133954418 16:10428287-10428309 TTTGTATGCATCAAATGTAGAGG + Intronic
1135027691 16:19011260-19011282 TTTAAATTCTTCAAGAATGGGGG - Intronic
1138725825 16:59137828-59137850 TTTGAATAATTCTAGTGTAGTGG + Intergenic
1138751392 16:59426648-59426670 TTTAAAAGCTACATATGTAGTGG - Intergenic
1139171444 16:64634862-64634884 TTGAAATGCTTGAAATGTAAAGG + Intergenic
1142650340 17:1346501-1346523 TGTAAATGCTTCATGTGTGTAGG - Intronic
1143666385 17:8364191-8364213 TTTAAATGTTTAATGTTTAGGGG + Intergenic
1147344967 17:39784707-39784729 TGTAAATCCTTAAAGTGTAGGGG + Intronic
1148359350 17:46998954-46998976 TGTAAATGCTCCATGTGAAGAGG + Intronic
1149136312 17:53368932-53368954 ATTAAATGCTTAAATTTTAGTGG + Intergenic
1149484705 17:57033362-57033384 TTTAGTTGCTTCAAGTGTAAAGG + Intergenic
1150753821 17:67891991-67892013 TTTATTTGCTTCATGTGCAGCGG - Exonic
1151637935 17:75365326-75365348 TTTAAATGGTTCTAATTTAGAGG - Intronic
1153132675 18:1874926-1874948 TGTAGATGCTTCAAGTTGAGAGG + Intergenic
1153812892 18:8767156-8767178 TTTAAGTGATTCAAGAGGAGGGG - Intronic
1156668945 18:39444153-39444175 AATAAATGCATCAAGGGTAGTGG + Intergenic
1156737298 18:40275873-40275895 TTTAAATGCATGAAGGGTGGAGG - Intergenic
1157228657 18:45892383-45892405 TTAAAATGACTCAAGTGGAGGGG - Intronic
1162541200 19:11297148-11297170 TTAAAATGTTACAAGTGAAGAGG - Intronic
1166865820 19:45836318-45836340 TTTTAAAGCTTCAAATGTATAGG - Intronic
925714382 2:6771413-6771435 CTGAAATGCATCACGTGTAGGGG - Intergenic
925749148 2:7071869-7071891 TTTAAGGCCTTCAAGTGAAGTGG - Intergenic
927693724 2:25226180-25226202 TTTCAATACTTCCAGTGAAGTGG + Intergenic
929057712 2:37892650-37892672 GTTGCATGCTTCAAATGTAGTGG + Intergenic
930816727 2:55606281-55606303 TTTAAATGTTTGAACTGTAATGG + Intronic
932002112 2:67894435-67894457 TCTAAATTCTACAAATGTAGTGG + Intergenic
932839370 2:75067502-75067524 TTGAGATGCTTGAAGTATAGTGG + Intronic
933321647 2:80782545-80782567 TTTAAATGCTGGGAGTGAAGGGG + Intergenic
933605187 2:84375263-84375285 TTTAAATTCTTTAAGTATTGAGG - Intergenic
935581853 2:104762594-104762616 TTGAAATAATTCATGTGTAGAGG + Intergenic
935920957 2:108014168-108014190 TGTAAATGCTTTAAGTGTAATGG + Intergenic
937450983 2:122001737-122001759 TTAAAATTCTTCAAGCGTAATGG - Intergenic
937594157 2:123653020-123653042 TCTAAATGCTTTTAGTGAAGTGG - Intergenic
939306279 2:140415804-140415826 TTTAATTCCTTCAAGACTAGAGG - Intronic
939787053 2:146528373-146528395 TTTAAATTTTTCAAGAGTATAGG - Intergenic
941286121 2:163614368-163614390 TCTAAATGCTTCTAGTGTCGTGG + Intronic
942113883 2:172708402-172708424 TATAATTGCTTTAACTGTAGGGG + Intergenic
942794310 2:179798335-179798357 TTTAAATACTACAAGTCTGGTGG + Intronic
943954212 2:194165285-194165307 TATAAATGCATCATGTTTAGTGG - Intergenic
944750923 2:202708755-202708777 TTTAAATTATTCAGGTGTGGTGG - Intronic
946789614 2:223286805-223286827 TTTAATTTCTTTCAGTGTAGAGG - Intergenic
947118176 2:226793340-226793362 TACAAATGCTTAAAGTGTTGAGG + Intronic
947328802 2:229006445-229006467 TTTACATGTTTCAAGAGTAAAGG - Intronic
947370576 2:229441302-229441324 TTAAAATGCTTGAAGTATTGAGG - Intronic
948513747 2:238489910-238489932 TTTAAATGCTTCTACAGCAGTGG + Intergenic
1169485874 20:6032176-6032198 TTTAAATGCATTGAGTATAGAGG + Intronic
1169595164 20:7190179-7190201 TTTTAATGCATCAAGTTTGGGGG - Intergenic
1169848280 20:10020841-10020863 GTTAAATGCCTCCAGTGTGGTGG - Intronic
1173073421 20:39792599-39792621 TGTAATTGCTTCATGTGTATTGG + Intergenic
1175353147 20:58340643-58340665 TTTAAGTTCTTTGAGTGTAGGGG - Intronic
1177590911 21:23165665-23165687 TTTAAATGCTTTAAGTCTCATGG - Intergenic
1178227916 21:30745720-30745742 TTTTTTTCCTTCAAGTGTAGAGG - Intergenic
1179129822 21:38624862-38624884 TTAAAATGCTTATAGTCTAGTGG - Intronic
951735016 3:25853709-25853731 TTTAAATGCTTCAGTTTCAGAGG - Intergenic
952247566 3:31611398-31611420 TTTAAATGCATAAATTGAAGAGG + Intronic
953700844 3:45194638-45194660 ATTAAATTAGTCAAGTGTAGTGG + Intergenic
954574642 3:51669176-51669198 TTTAATTTCTTCAAGGGGAGGGG + Intronic
955283624 3:57617712-57617734 TTTAAATTAGCCAAGTGTAGTGG + Intergenic
956925955 3:73988595-73988617 TATAAATATTTCAAGGGTAGTGG + Intergenic
957956918 3:87199099-87199121 TTTAAATGTCTCAAGTGATGAGG + Intergenic
958492249 3:94792027-94792049 TTTAAATGCTTCTAAAGAAGAGG - Intergenic
959242594 3:103816601-103816623 TTTATTTGCTTCAAGTTTAAAGG + Intergenic
959287742 3:104438647-104438669 TTTAAATGCTTGAAGTGAAAGGG + Intergenic
959296958 3:104547841-104547863 TTTGAATGTTTCCAGTATAGAGG - Intergenic
959424698 3:106172351-106172373 TATGAATGCTTAAAGTATAGTGG - Intergenic
959606195 3:108244379-108244401 TTTGAATTCTTCAAGTCTATAGG - Intergenic
959913563 3:111792552-111792574 TTAAAATTCGCCAAGTGTAGTGG + Intronic
960778076 3:121284404-121284426 TTTAAATGCTTCCAGTGTCCAGG + Intronic
960815851 3:121671631-121671653 TTTAAATGCTTCTAGCGTAAAGG - Intronic
961993133 3:131213567-131213589 TTTAAATCCTTCAGCTGTGGTGG + Intronic
962297904 3:134210005-134210027 ATTAAATGCTTAATGTCTAGAGG - Intronic
963451862 3:145491833-145491855 TTTAAAGGCATCAAGTTTTGAGG + Intergenic
964298820 3:155264382-155264404 TAAAAATACTTCAAGTTTAGAGG - Intergenic
964874383 3:161349611-161349633 TTTAAAGTCATCAAGTTTAGAGG - Intronic
965572664 3:170187359-170187381 TTTAATTGCTTCAAGTTTCTTGG + Intergenic
965965592 3:174485301-174485323 TTAAAAACCTTCAAGTTTAGGGG + Intronic
971248492 4:24951479-24951501 TTAAAAAGCCTCAAGTCTAGTGG + Intronic
972410514 4:38788853-38788875 TTTAAATGAGCCAGGTGTAGTGG + Intergenic
974813587 4:66977284-66977306 TTTAAAATGTTCAGGTGTAGAGG - Intergenic
975568457 4:75786630-75786652 TTTAAATATTTCCAGTTTAGGGG + Intronic
976448559 4:85160662-85160684 TTTAAATACTTCAAGTTCTGGGG + Intergenic
977245295 4:94623875-94623897 GTTAAATGCTTCAAGAAGAGTGG - Intronic
977573311 4:98652231-98652253 TATAAGGGCTTCAAGTGTGGGGG - Intronic
980192479 4:129542655-129542677 CTTAAAAGATTCAAGAGTAGTGG + Intergenic
980607952 4:135117956-135117978 TTTAAATGCTTGGAGTTTGGAGG - Intergenic
981106678 4:140889601-140889623 TTTAAATGCTACAAAGGTACAGG + Intronic
982990976 4:162273386-162273408 TCAAAATACTTCAAATGTAGTGG - Intergenic
983701464 4:170600469-170600491 TTTAATTTCTTTAACTGTAGTGG + Intergenic
984073305 4:175144231-175144253 TTTTAATGGTTTAACTGTAGAGG - Intergenic
985517080 5:352593-352615 TTTAAATGGGTCAGCTGTAGGGG + Intronic
986746593 5:10750282-10750304 CTTACATGCTTCAGGTGTACTGG + Intronic
987350704 5:17019380-17019402 ATTAAATGGGTCAGGTGTAGTGG + Intergenic
989785835 5:45328365-45328387 ATAAAATGCTTCAAGTGAAAAGG - Intronic
990212096 5:53491796-53491818 TTGAAATGATTCTAGAGTAGTGG - Intergenic
994046055 5:95311166-95311188 TTTAATTGTATCAAATGTAGGGG - Intergenic
995755723 5:115501948-115501970 TTTAAATACTTCCAGTGCTGGGG - Intergenic
996677677 5:126195391-126195413 TTTAAATGCTACAAGTCAATGGG + Intergenic
996887035 5:128369420-128369442 TTGAAAAGCTTCCAGTCTAGTGG - Intronic
997426473 5:133806146-133806168 TTGAAATGCTGCGAGGGTAGAGG + Intergenic
998483173 5:142479822-142479844 TTAAAATGCTTCAAAGGAAGAGG + Intergenic
1000154324 5:158535794-158535816 TTTAAATGGTCCAAGGTTAGAGG + Intergenic
1000585009 5:163086629-163086651 TTTACATTCTTTAAATGTAGGGG + Intergenic
1001230213 5:169980403-169980425 TTTATATGCAAGAAGTGTAGTGG + Exonic
1001924971 5:175629484-175629506 CTTAAATGATTCCAGGGTAGAGG + Intergenic
1003961479 6:11213211-11213233 TCCAAATGCTCCAAGTGTAATGG + Intronic
1004520100 6:16353718-16353740 TTTCACTGCTTCAAGTTTAATGG - Intronic
1012574062 6:100768777-100768799 CTTAAATGTTTCAAGAGCAGTGG - Intronic
1012747570 6:103113517-103113539 TTTAAACTCATCAAGAGTAGAGG - Intergenic
1013385572 6:109626769-109626791 TTTAAATGCTACAGCTGTATAGG + Intronic
1014507401 6:122276497-122276519 TTTAAAACCTTCAATTGCAGAGG - Intergenic
1016026653 6:139294306-139294328 TTTGAATGAATCAAGTGTTGAGG - Intergenic
1016244239 6:141964060-141964082 TTTTGATGCTTCCAGTATAGAGG - Intergenic
1016544434 6:145204716-145204738 TTGATATGCTTCTAATGTAGTGG - Intergenic
1018176997 6:161185934-161185956 TTTAATCGCTTCAAATATAGTGG - Intronic
1019121938 6:169810976-169810998 TTTAAAGGCTTCACCTGTTGAGG + Intergenic
1026464249 7:70640359-70640381 TCTAAATGAGTCAAGTGTTGGGG - Intronic
1028015197 7:85701238-85701260 TTTAAATCCTTAAAGTGAGGAGG + Intergenic
1029050542 7:97681923-97681945 TGAAAATGCTTCATGTGAAGTGG + Intergenic
1033192987 7:139299785-139299807 TTTAATTTTTTCAAATGTAGTGG + Exonic
1033878449 7:145852171-145852193 TCTAAAAGTTTCAAGTGTATAGG + Intergenic
1036988262 8:13561467-13561489 ATTAAATCCTGCACGTGTAGTGG - Intergenic
1037203811 8:16290375-16290397 TCCAAATGCTTCAAGGATAGGGG - Intronic
1037212249 8:16404900-16404922 TTTTTATGCTTCAAGTTCAGTGG - Intronic
1037919551 8:22795773-22795795 TTTAAATGCTTCACATTTATTGG + Intronic
1038447660 8:27615083-27615105 TTTAAATGGGTCAAGAGAAGTGG - Intergenic
1038891307 8:31727556-31727578 TTTCAATTCTTCAAATGTATAGG + Intronic
1040067398 8:43158431-43158453 TTTAAATTATTGAAATGTAGAGG + Intronic
1040935842 8:52781116-52781138 GAGAAATGCTTCAAGTTTAGGGG + Intergenic
1041931214 8:63288675-63288697 TTAAAATGGTTCAAATTTAGTGG - Intergenic
1043055684 8:75434795-75434817 TTTAAATGTTTTAAGTGTACAGG - Intronic
1044100081 8:88124210-88124232 TTTTAATTCTGCAAGTGTTGGGG - Intronic
1046185991 8:110719211-110719233 TTAAAATGCATCAGGTTTAGGGG - Intergenic
1046326848 8:112660020-112660042 TTTAAATGACTCACGAGTAGTGG + Intronic
1046438040 8:114220214-114220236 TTTAAGTGCTTAAACTGGAGGGG - Intergenic
1048144394 8:131826096-131826118 ATTAAATGATTCAAGAGCAGTGG - Intergenic
1049394025 8:142390106-142390128 TTTAAATGATACAACTGTATAGG + Intronic
1050769401 9:9177843-9177865 TTTAAAAGCTAAAAGTATAGTGG + Intronic
1051214024 9:14777051-14777073 TTTAAACTCTGCAAGAGTAGTGG - Intronic
1055072860 9:72185306-72185328 TTTAAATGCCTAAGGTGCAGGGG - Intronic
1055287527 9:74745205-74745227 GTGAAATGCTTAAAGTGTATGGG + Intronic
1057484274 9:95470031-95470053 TTCAAATGCTTCAAGAGGAAAGG - Intronic
1057543637 9:96000469-96000491 TTTAAATCCCTTAAGGGTAGGGG + Intronic
1058356943 9:104094197-104094219 CTTTAATCCTTCGAGTGTAGGGG + Intergenic
1061750859 9:132776189-132776211 TTAAAATGCTACAACTCTAGGGG + Intronic
1062246562 9:135570855-135570877 TTTAAGTGCTCCAAATGTAAAGG - Intergenic
1062345606 9:136113240-136113262 TTCAAATGAGTCAGGTGTAGTGG - Intergenic
1186049675 X:5577483-5577505 TGTAAATGGTGCAAGTGAAGGGG - Intergenic
1187007378 X:15245962-15245984 TTTAAATGCTTTGAGTATACTGG - Intronic
1188512542 X:30951955-30951977 TATATATACTTCAAGTGAAGTGG - Intronic
1190037749 X:47041528-47041550 TTTAAATGAGCCAGGTGTAGTGG - Intronic
1191988511 X:67007691-67007713 TATAAAAGCTTCAAGAGAAGAGG + Intergenic
1192364585 X:70460558-70460580 TTTTAATTCTTCAAGTGAAATGG + Intronic
1193995498 X:88362281-88362303 TTTAACTGTTTCACGTGTAGTGG + Intergenic
1195011621 X:100737783-100737805 TTAAAGTGCTTCACATGTAGTGG - Intergenic
1196735916 X:118981052-118981074 GTAAAATGCCCCAAGTGTAGGGG + Intronic
1197173349 X:123458504-123458526 CTTAAATGCTTCTGGTGAAGAGG - Intronic
1197269982 X:124414710-124414732 TTAAAATGCATCTTGTGTAGTGG - Intronic
1199732537 X:150650673-150650695 TTTGAATGCTGCCAGTGTGGGGG - Intronic
1200823950 Y:7620010-7620032 TTTAAAAACTTCCAGTGTCGTGG - Intergenic
1201713694 Y:17019964-17019986 TTTAAATATTTAAAGTTTAGAGG + Intergenic
1202236105 Y:22711078-22711100 TTTAAAAACTTCCAGTGTCGTGG + Intergenic
1202307058 Y:23485090-23485112 TTTAAAAACTTCCAGTGTCGTGG - Intergenic
1202563747 Y:26185496-26185518 TTTAAAAACTTCCAGTGTCGTGG + Intergenic