ID: 1068831208

View in Genome Browser
Species Human (GRCh38)
Location 10:61497346-61497368
Sequence CAAGTGGAACAGTTTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068831206_1068831208 -6 Left 1068831206 10:61497329-61497351 CCATAAAATTGTGTCTTCAAGTG No data
Right 1068831208 10:61497346-61497368 CAAGTGGAACAGTTTTGCCCAGG No data
1068831205_1068831208 -5 Left 1068831205 10:61497328-61497350 CCCATAAAATTGTGTCTTCAAGT No data
Right 1068831208 10:61497346-61497368 CAAGTGGAACAGTTTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068831208 Original CRISPR CAAGTGGAACAGTTTTGCCC AGG Intergenic
No off target data available for this crispr