ID: 1068836255

View in Genome Browser
Species Human (GRCh38)
Location 10:61557340-61557362
Sequence CAATAACGCTTTAATGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068836255_1068836257 15 Left 1068836255 10:61557340-61557362 CCATGTTCATTAAAGCGTTATTG No data
Right 1068836257 10:61557378-61557400 CCAAGATGTAGAAACAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068836255 Original CRISPR CAATAACGCTTTAATGAACA TGG (reversed) Intergenic
No off target data available for this crispr