ID: 1068838824

View in Genome Browser
Species Human (GRCh38)
Location 10:61587529-61587551
Sequence GGGGAACAGAATTGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068838818_1068838824 10 Left 1068838818 10:61587496-61587518 CCAAAAGCAGAAGCTTTGAGTTA No data
Right 1068838824 10:61587529-61587551 GGGGAACAGAATTGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068838824 Original CRISPR GGGGAACAGAATTGGAAGCC AGG Intergenic
No off target data available for this crispr