ID: 1068839100

View in Genome Browser
Species Human (GRCh38)
Location 10:61590290-61590312
Sequence TTTCACATTGTGATGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068839096_1068839100 0 Left 1068839096 10:61590267-61590289 CCCTTATTTGAATAAGTGACTGC No data
Right 1068839100 10:61590290-61590312 TTTCACATTGTGATGGTGGTAGG No data
1068839097_1068839100 -1 Left 1068839097 10:61590268-61590290 CCTTATTTGAATAAGTGACTGCT No data
Right 1068839100 10:61590290-61590312 TTTCACATTGTGATGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068839100 Original CRISPR TTTCACATTGTGATGGTGGT AGG Intergenic
No off target data available for this crispr