ID: 1068839100 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:61590290-61590312 |
| Sequence | TTTCACATTGTGATGGTGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068839096_1068839100 | 0 | Left | 1068839096 | 10:61590267-61590289 | CCCTTATTTGAATAAGTGACTGC | No data | ||
| Right | 1068839100 | 10:61590290-61590312 | TTTCACATTGTGATGGTGGTAGG | No data | ||||
| 1068839097_1068839100 | -1 | Left | 1068839097 | 10:61590268-61590290 | CCTTATTTGAATAAGTGACTGCT | No data | ||
| Right | 1068839100 | 10:61590290-61590312 | TTTCACATTGTGATGGTGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068839100 | Original CRISPR | TTTCACATTGTGATGGTGGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||