ID: 1068844846

View in Genome Browser
Species Human (GRCh38)
Location 10:61660290-61660312
Sequence GACCTCAGGAATCACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068844844_1068844846 23 Left 1068844844 10:61660244-61660266 CCTGATCTTCTTAAGATTATCAT No data
Right 1068844846 10:61660290-61660312 GACCTCAGGAATCACAGTGTTGG No data
1068844843_1068844846 27 Left 1068844843 10:61660240-61660262 CCTGCCTGATCTTCTTAAGATTA No data
Right 1068844846 10:61660290-61660312 GACCTCAGGAATCACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068844846 Original CRISPR GACCTCAGGAATCACAGTGT TGG Intergenic
No off target data available for this crispr