ID: 1068845082

View in Genome Browser
Species Human (GRCh38)
Location 10:61662948-61662970
Sequence GCTTCTCTCGGCCGAGATTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068845072_1068845082 7 Left 1068845072 10:61662918-61662940 CCACCCCAGTTGCCTAGGTGACG 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845066_1068845082 23 Left 1068845066 10:61662902-61662924 CCCAGGGACGCCGGCCCCACCCC 0: 1
1: 1
2: 0
3: 66
4: 366
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845073_1068845082 4 Left 1068845073 10:61662921-61662943 CCCCAGTTGCCTAGGTGACGAGG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845079_1068845082 -5 Left 1068845079 10:61662930-61662952 CCTAGGTGACGAGGGGCCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845075_1068845082 3 Left 1068845075 10:61662922-61662944 CCCAGTTGCCTAGGTGACGAGGG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845071_1068845082 8 Left 1068845071 10:61662917-61662939 CCCACCCCAGTTGCCTAGGTGAC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845064_1068845082 29 Left 1068845064 10:61662896-61662918 CCCAGGCCCAGGGACGCCGGCCC 0: 1
1: 0
2: 2
3: 29
4: 309
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845065_1068845082 28 Left 1068845065 10:61662897-61662919 CCAGGCCCAGGGACGCCGGCCCC 0: 1
1: 0
2: 3
3: 54
4: 458
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845067_1068845082 22 Left 1068845067 10:61662903-61662925 CCAGGGACGCCGGCCCCACCCCA 0: 1
1: 0
2: 1
3: 36
4: 420
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845070_1068845082 9 Left 1068845070 10:61662916-61662938 CCCCACCCCAGTTGCCTAGGTGA 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845068_1068845082 13 Left 1068845068 10:61662912-61662934 CCGGCCCCACCCCAGTTGCCTAG 0: 1
1: 0
2: 6
3: 28
4: 362
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1068845077_1068845082 2 Left 1068845077 10:61662923-61662945 CCAGTTGCCTAGGTGACGAGGGG 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068845082 Original CRISPR GCTTCTCTCGGCCGAGATTG CGG Exonic
901680523 1:10910219-10910241 GCTTCTCTGGGCCCTGTTTGGGG + Intergenic
904566245 1:31429957-31429979 CCTTCTCTCGGGGGAGAGTGTGG - Intronic
905208150 1:36354781-36354803 GCTTCTGTGGGCCGAGCCTGTGG - Intronic
908199244 1:61777465-61777487 GCTGCTTTGAGCCGAGATTGTGG + Intronic
910671937 1:89782452-89782474 GATTCTCTGGGCCCAAATTGTGG + Intronic
915322383 1:155062925-155062947 GCTTCCCTCTGCCCAGACTGGGG + Intergenic
1068845082 10:61662948-61662970 GCTTCTCTCGGCCGAGATTGCGG + Exonic
1071317465 10:84416168-84416190 ACTTCTCTTGGCAGAGGTTGGGG + Intronic
1079719289 11:23790098-23790120 GCTTATCTCTGCCCAGATTGTGG + Intergenic
1089687954 11:120169029-120169051 CCTTCTCTCCGCCGCGAATGCGG + Exonic
1089973128 11:122710577-122710599 GCTTCTGGAGGCAGAGATTGAGG - Intronic
1091932853 12:4410686-4410708 GCTTTTCTTGGCCAAGATTAGGG - Intergenic
1096423744 12:51483130-51483152 GCTTCTCTCGGCCTTGGTGGAGG + Intronic
1113857068 13:113452866-113452888 GCCTCTCTCGGCCGTGCTGGTGG - Intronic
1119881054 14:78100093-78100115 GCTTCTCTAGGGCCAGACTGTGG + Intergenic
1119893172 14:78198197-78198219 GCTTCTCTCAGAAGAGGTTGTGG - Intergenic
1121149016 14:91613775-91613797 GCTACTCTAGGGCGAGATTTTGG - Intronic
1132571671 16:646956-646978 GCTTCTGTGGGGCGAGAATGTGG + Intronic
1133060420 16:3171172-3171194 GCTTCTCGCTGCCGCGATCGTGG - Intergenic
1134183023 16:12062691-12062713 CCTTCTCTGGGCCCAGATTTAGG + Intronic
1137261368 16:46832186-46832208 GCTTCAGTGAGCCGAGATTGTGG + Intergenic
1138419981 16:56892757-56892779 GCTTCTCTCTCCCGGGATTCTGG - Intronic
1140132736 16:72178165-72178187 GTTTCTCTGTGCTGAGATTGAGG + Intergenic
1144708490 17:17385259-17385281 GCTCCTCTCGGCCTAGGGTGGGG - Intergenic
1147953668 17:44120881-44120903 GCTTCTGTTGGCCTAGCTTGGGG - Intronic
1151384243 17:73745466-73745488 GCTTCTCTCAGCCCAGGTAGGGG - Intergenic
1161895006 19:7073736-7073758 CCTTCTCTCCCCGGAGATTGGGG + Intronic
1162468674 19:10858819-10858841 GTTTCTCTCCTCCGAGAGTGGGG + Intronic
936861902 2:117029307-117029329 GCTTCTCTTGGCTGAGGGTGGGG - Intergenic
937324727 2:120983645-120983667 GGTTCTCTCAGCCCAGATAGGGG - Intronic
940240823 2:151561484-151561506 GCTTCTCTTGACTGAGACTGGGG + Intronic
948281417 2:236750308-236750330 GCTTCTCTCTGCCCAGTGTGGGG - Intergenic
948281430 2:236750366-236750388 GCTTCTCTCTGCCCAGTGTGGGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1173530342 20:43764661-43764683 GCTTCTCTGAGCCGTGATAGTGG + Intergenic
953816760 3:46164108-46164130 GCTTCTCTTGGCTGGGAGTGGGG + Intronic
954080042 3:48208191-48208213 GCTTCTCTCAGCAGAGTCTGGGG - Intergenic
954356946 3:50089516-50089538 GGGTCTCGCGGCCGAGATGGCGG - Intronic
957268694 3:78001868-78001890 GGATCTCTCAGCAGAGATTGGGG - Intergenic
959777267 3:110181854-110181876 GCTTCTCTCAGTAGAGATTAAGG + Intergenic
979708251 4:123747142-123747164 GCTTCTTTCGGCTGAGCTGGTGG + Intergenic
986333687 5:6736918-6736940 GTTTCTCTCTGCTGAGACTGTGG + Intronic
998084167 5:139303161-139303183 GCTGCACTGAGCCGAGATTGGGG - Intronic
1010660054 6:78559217-78559239 GCATCTCTCTCCCGAGGTTGTGG + Intergenic
1013988129 6:116221374-116221396 GCTGCTGTCAGCAGAGATTGAGG - Intronic
1024249542 7:47495867-47495889 CCTTCCCTCTGCCGAGATGGAGG - Intronic
1024589908 7:50872404-50872426 GCTTCTCTTGGCTGAGGGTGGGG - Intergenic
1027200064 7:76058378-76058400 GCTCCTTTCAGCCGTGATTGTGG + Intronic
1043958881 8:86392195-86392217 GTTTTTCTAGGCCAAGATTGAGG + Intronic
1046690580 8:117280081-117280103 TCTTCTCTCTACCGAGGTTGAGG - Intergenic
1051615377 9:19000570-19000592 GCTTCTCTCTTCCCAGATGGTGG - Intronic
1055842806 9:80526295-80526317 GCTTCTCTCAGCTGTGTTTGTGG - Intergenic
1057716510 9:97500212-97500234 GCTTATCTCTGCCGAAGTTGAGG + Intergenic
1058901823 9:109448628-109448650 GCCTCTCTCAGCCAAGACTGAGG + Intronic
1188446456 X:30257685-30257707 GTTTCTCTTAGCTGAGATTGAGG + Intergenic
1200141459 X:153904826-153904848 GCCTCTCTCGGCCTCGGTTGGGG + Intronic