ID: 1068848379

View in Genome Browser
Species Human (GRCh38)
Location 10:61706952-61706974
Sequence CTTTATACAAAGGTGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068848379_1068848385 14 Left 1068848379 10:61706952-61706974 CCAGCCTGCACCTTTGTATAAAG 0: 1
1: 1
2: 1
3: 10
4: 159
Right 1068848385 10:61706989-61707011 CCTCCTCAATGACCCATTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068848379 Original CRISPR CTTTATACAAAGGTGCAGGC TGG (reversed) Intronic
901238892 1:7681575-7681597 CTTCATACAAAGATGCAAGGGGG + Intronic
906244175 1:44261697-44261719 ATTTGAACAAAAGTGCAGGCAGG - Intronic
909959340 1:81819855-81819877 CTTTCTGAAAAGGGGCAGGCTGG - Intronic
911269913 1:95788575-95788597 CTTTATAAAAAAGTGAAAGCTGG - Intergenic
911873342 1:103127858-103127880 CTTAAGACAAAGTTACAGGCCGG + Intergenic
915443652 1:155962219-155962241 CTTTCTACAAGGGAGGAGGCAGG + Exonic
916409738 1:164534494-164534516 CTTTACACATAGCTGCAGGCCGG + Intergenic
917586272 1:176430306-176430328 TTTCATACAAATGTCCAGGCTGG + Intergenic
919412233 1:197259851-197259873 CTTAAAACAAAGTTTCAGGCCGG + Intergenic
1062817655 10:512617-512639 CATTATAGAAAGGAGCTGGCCGG + Intronic
1063196926 10:3752366-3752388 CATCATACAAAGGTGCACACTGG - Intergenic
1063829198 10:9932725-9932747 CTTTAATCACAGGTGAAGGCTGG - Intergenic
1064567410 10:16655466-16655488 CTTTATACAAGTTTTCAGGCAGG - Intronic
1064577851 10:16763887-16763909 CTTTATGCAAAGGTGAAGAGAGG - Intronic
1065005922 10:21379986-21380008 CTATTTACAAAGCTGCGGGCAGG - Intergenic
1065179069 10:23106826-23106848 CTGTTTACAAAGGTGCAGACGGG - Intronic
1065499587 10:26366390-26366412 ATTTATAAGAAGGTGCTGGCTGG - Intergenic
1067311249 10:45115434-45115456 CTTTATGCAAAGGTGAAGAGAGG - Intergenic
1068272178 10:54742654-54742676 CTTTATACCAGGGTGAAGTCGGG + Intronic
1068848379 10:61706952-61706974 CTTTATACAAAGGTGCAGGCTGG - Intronic
1069391838 10:67944196-67944218 GTGTCTACAAAGGTGCTGGCTGG + Intronic
1071366034 10:84901403-84901425 CTGTTTACAAAGGTGAGGGCAGG - Intergenic
1072452623 10:95551041-95551063 CTTTGTACCAACTTGCAGGCAGG - Intronic
1072663840 10:97380150-97380172 CTTTATACAAGAGGCCAGGCAGG - Intronic
1074973996 10:118565908-118565930 CATTGGACAAAGGTGAAGGCTGG - Intergenic
1075052416 10:119192532-119192554 CTTTTTAAAAGGGTGGAGGCCGG - Intergenic
1076387478 10:130067707-130067729 CATCATACAAAGATGCATGCTGG - Intergenic
1077067705 11:650654-650676 TTTTTTAAAAAGATGCAGGCTGG + Intronic
1079858607 11:25638639-25638661 ATTTTTACAAATGTGTAGGCAGG - Intergenic
1080587250 11:33693258-33693280 GTGTTTACAAAGGTGCAGGCAGG - Intergenic
1080630871 11:34074569-34074591 CTTTATAGGTAGGTGGAGGCAGG - Intronic
1080838872 11:35966129-35966151 CTTTATTTAAAAATGCAGGCTGG + Intronic
1081911523 11:46702984-46703006 CTTGGTACAACGGGGCAGGCTGG + Exonic
1083386370 11:62313227-62313249 CTCTTTACAAAGGTGTGGGCAGG - Intergenic
1084869597 11:72089052-72089074 CATCATTCAAAGGTGCAAGCAGG - Intronic
1089304270 11:117516890-117516912 CTTTTTACAAAGCTACAGACAGG + Intronic
1089318382 11:117607538-117607560 CTAGCTACAGAGGTGCAGGCAGG + Intronic
1089645317 11:119875008-119875030 CTTTATTTACAGGTGCAGCCTGG - Intergenic
1093785259 12:23185209-23185231 CTTTATACACTGGTACAGCCTGG - Intergenic
1095494534 12:42770726-42770748 TTTGTTACAAATGTGCAGGCTGG + Intergenic
1096649516 12:53055078-53055100 CTCTAAAATAAGGTGCAGGCCGG - Intronic
1097242513 12:57585350-57585372 CTTTAAAGAAAGGGGCAGGGTGG + Exonic
1100250634 12:92819369-92819391 CTTTATGCAAAAATTCAGGCTGG - Exonic
1101458592 12:104864269-104864291 CTTTATACAAAGGGGTAGAGGGG + Intronic
1102715923 12:114972372-114972394 CTTTTTAAAAATGTTCAGGCTGG - Intergenic
1102919735 12:116782887-116782909 CTATTTACAAAGGTGCGGGCAGG - Intronic
1105255224 13:18739761-18739783 CTGTTTACAAAGGTGTGGGCAGG - Intergenic
1106356888 13:28991770-28991792 CTTTAAACAAAGGGGAAGGAGGG - Intronic
1106792133 13:33166510-33166532 CTCATTGCAAAGGTGCAGGCAGG - Intronic
1109075483 13:57829317-57829339 CTTTATAGAAAGGTGAAGTTTGG - Intergenic
1112241290 13:97684033-97684055 CTATTTACAAAGGTATAGGCAGG - Intergenic
1112637491 13:101231872-101231894 CTTAGTACAAAGGTGCAAGAAGG + Intronic
1113004727 13:105687314-105687336 CTGTCTACGAAGGGGCAGGCAGG + Intergenic
1116390877 14:44387740-44387762 CTTTATTTAAAAGAGCAGGCTGG - Intergenic
1117229657 14:53702900-53702922 CTTTATACTCAGTTGCAGACTGG - Intergenic
1118465376 14:66025832-66025854 CTTCTTACAAAGGTGTGGGCAGG + Intergenic
1119678184 14:76572082-76572104 CTTAATAAGAAGATGCAGGCTGG - Intergenic
1121230130 14:92351554-92351576 CTTACTTGAAAGGTGCAGGCAGG + Intronic
1121591695 14:95118513-95118535 GTTAATACAGAGGAGCAGGCAGG - Intronic
1123137305 14:106040103-106040125 CTATATATAAAGGGGTAGGCTGG + Intergenic
1123429426 15:20202282-20202304 CTATTTACAAAGGTGCAAGCAGG - Intergenic
1125553237 15:40563738-40563760 CTTTGGAGAAAAGTGCAGGCTGG - Intronic
1125995967 15:44161318-44161340 CTATACTCAGAGGTGCAGGCAGG - Intronic
1126066360 15:44829043-44829065 CTTCATACATGCGTGCAGGCTGG + Intergenic
1128689811 15:69715130-69715152 CTTTTTACAAAGGAGAAGTCAGG + Intergenic
1132163317 15:99563393-99563415 CTTTCTTCAAAGGGGCTGGCAGG - Intergenic
1135006871 16:18832731-18832753 CTTAAAAAAAAAGTGCAGGCAGG - Intronic
1138622866 16:58225699-58225721 CTCTTTACTAAGGTGAAGGCAGG + Intergenic
1140720681 16:77768972-77768994 CTCTATGCAAATGTGCAGGCTGG + Intergenic
1141026564 16:80554323-80554345 CTGGATGCAAAGGTACAGGCAGG - Intergenic
1143916157 17:10294944-10294966 CTCTCTACAAAGGTGTGGGCAGG + Intergenic
1144052628 17:11510045-11510067 CTCTGTGCAAAGCTGCAGGCAGG - Intronic
1144223803 17:13125113-13125135 ATTTATAGAAAATTGCAGGCCGG + Intergenic
1149431999 17:56601715-56601737 CTTCATACAAAAATGCAAGCTGG - Intergenic
1149457821 17:56802551-56802573 CTTTTTACAAAGGCGTGGGCAGG - Intronic
1150964296 17:69950195-69950217 CTTTATAAAAATGTGCAGAGAGG - Intergenic
1151172543 17:72259489-72259511 CTTTAAAAAAAGGTGGTGGCAGG + Intergenic
1151833298 17:76568445-76568467 GTTTATACAAAGGCACAGACTGG - Intronic
1152990690 18:361257-361279 CTCTATACAATGTTGCAGTCAGG + Intronic
1165539748 19:36482643-36482665 CTTTTTACACAGGTCCAGGTTGG + Intronic
1165867406 19:38947178-38947200 CTGTTTACAAAGTTGTAGGCAGG - Intronic
1165961225 19:39536095-39536117 CTTTTTACAAAGGCTGAGGCAGG - Intergenic
1166973917 19:46592148-46592170 CTTTATAAAAAGGTGGATGCTGG - Intronic
1167055625 19:47110305-47110327 CTTTCTTCAAAGATGAAGGCTGG + Intronic
1168471657 19:56645050-56645072 TTATATACAAATGTGCAGACTGG + Intronic
927158095 2:20233561-20233583 CTTTTTAAAATGGTGTAGGCTGG - Intergenic
929693084 2:44090738-44090760 CTATTTACAAAGGTGCAGGCAGG - Intergenic
931009920 2:57898715-57898737 ATTTCTACAAAGAAGCAGGCTGG + Intergenic
932514762 2:72334444-72334466 CATTCTACAAAGGAGGAGGCGGG + Intronic
933076549 2:77934788-77934810 CTTTTTAAAATGGTGCAGGTGGG - Intergenic
934490195 2:94756998-94757020 CTGTTTACAAAGGTGTGGGCTGG - Intergenic
940832626 2:158484341-158484363 CTTTGAAAAAATGTGCAGGCCGG - Intronic
941815127 2:169788448-169788470 CTTTTTACAAAGGTGTGGGAAGG - Intergenic
941962216 2:171264767-171264789 CTATTTACAAAATTGCAGGCAGG + Intergenic
947121275 2:226817839-226817861 CTTGTTAAAAAGGTGCATGCTGG - Intergenic
948402878 2:237696733-237696755 CTGTATGCAATGCTGCAGGCAGG + Intronic
948719873 2:239892869-239892891 CTATCTACAAATGTGTAGGCAGG + Intronic
1170211131 20:13847198-13847220 GTTTATAGAAATGTGCAGGAAGG - Intergenic
1170688898 20:18594314-18594336 CTTTTTACTAAGGTGGTGGCGGG + Intronic
1171330367 20:24332168-24332190 CTCTCTCCAAAGGTGCAGCCTGG + Intergenic
1175679252 20:60973531-60973553 CTTTATAGAGAGCTGCAGGAAGG + Intergenic
1176911117 21:14566469-14566491 CATTTTACAAAGGTAAAGGCAGG + Intronic
1178227336 21:30737452-30737474 CTTTATAAACATTTGCAGGCTGG - Intergenic
1179896082 21:44364517-44364539 CTTTCTAGGAAGGTGCAAGCTGG + Intronic
949569163 3:5275290-5275312 CTTTATAGAAAGATACAGGATGG + Intergenic
953521202 3:43644877-43644899 CTCTTTACAGAGGTGCAGACAGG - Intronic
958571507 3:95888965-95888987 CTTTAAAAAAAGGTCCTGGCCGG - Intergenic
959615524 3:108342935-108342957 CATAATACAGAGATGCAGGCAGG - Intronic
960943894 3:122952990-122953012 CTGTTTACAAAGGTGTAGGAAGG - Intronic
962348831 3:134642178-134642200 CTCTATAGAAAGGCGCTGGCAGG - Intronic
967542620 3:190684997-190685019 CATTATACAGAGGAGGAGGCTGG - Intergenic
969482857 4:7456001-7456023 CTTGAGACCAAGGTGTAGGCAGG + Intronic
971087380 4:23294611-23294633 CTATTTTCAAAGGTGAAGGCAGG - Intergenic
974408892 4:61512804-61512826 CTTTGTACAAAGGATTAGGCGGG + Intronic
975148420 4:70994360-70994382 CTGAATACAAAGGAGCAGGTAGG - Intronic
975445125 4:74454893-74454915 CTGTATATAAAGGTGCACGAAGG + Exonic
980605863 4:135087976-135087998 CTATATACAAAGGTACACACAGG + Intergenic
982049808 4:151489497-151489519 CTACAGCCAAAGGTGCAGGCAGG + Intronic
982507644 4:156240244-156240266 TTTTACACAAAGGAGCAGGGAGG - Intergenic
983097827 4:163585824-163585846 CTTTATCCACTGGTGGAGGCAGG + Exonic
986524957 5:8663884-8663906 ATTTATACAGAGCTGCAGCCAGG - Intergenic
988507107 5:31833170-31833192 CTAGAAACAAAGGTGGAGGCTGG + Intronic
988510955 5:31864332-31864354 CTGTTTACAGAGGTGCAGACCGG - Intronic
990378436 5:55196846-55196868 CTTTTTAAAAATGTGTAGGCTGG + Intergenic
990442243 5:55858577-55858599 CTTTAGAAAAATGTGCATGCAGG - Intronic
991046961 5:62232718-62232740 CTATTTACAAAGGTGCAAGCAGG - Intergenic
992022079 5:72634749-72634771 CTGTTTACAATAGTGCAGGCAGG + Intergenic
992656725 5:78917807-78917829 CTTTAAACATAACTGCAGGCTGG - Intronic
992821530 5:80502198-80502220 CTTTATAAAAATGTTCAGCCTGG - Intronic
996824061 5:127661282-127661304 CATTATAAAAAGCTTCAGGCCGG - Intergenic
997632619 5:135380220-135380242 CTGTATACAAAGGTGAGGGAGGG + Intronic
1001926400 5:175640223-175640245 CTTTTTACAAAGGTGCAGGCAGG - Intergenic
1002086771 5:176780782-176780804 CTAATTACATAGGTGCAGGCAGG - Intergenic
1002790118 6:431173-431195 ATTTGTACAAAGGTACAGTCAGG - Intergenic
1006037974 6:31228984-31229006 CCTTCTACACAGGTGCCGGCAGG - Intergenic
1007243498 6:40443605-40443627 CAATAAAGAAAGGTGCAGGCAGG - Intronic
1013108237 6:107044274-107044296 CTTTCTACAAAGGTGAACTCAGG + Exonic
1013328075 6:109068173-109068195 CTGTCTACAAAGGTGTATGCAGG - Intronic
1013455585 6:110326624-110326646 CTATTTACAAAGGTGTGGGCAGG + Intronic
1013599906 6:111694002-111694024 TTTTTTACAAAGGCACAGGCAGG - Intronic
1015990784 6:138940448-138940470 TTTTAAAGAAAGGTCCAGGCTGG + Intronic
1016147720 6:140696139-140696161 ATATATACAAAGATGTAGGCTGG + Intergenic
1019059465 6:169245243-169245265 CATTTTACAAAGATGAAGGCTGG - Intronic
1022342628 7:29483115-29483137 CTCTAGAAAAAAGTGCAGGCCGG - Intronic
1023639630 7:42244427-42244449 CTTCATACAAAAGTGCTGGTTGG - Intergenic
1026788193 7:73314923-73314945 CTTTACACACAGGCACAGGCAGG - Intronic
1030170671 7:106599531-106599553 CTATTTACACAGGTGCTGGCAGG - Intergenic
1031176230 7:118354817-118354839 ATTTATACAAAGGTGCAAAGGGG - Intergenic
1032711925 7:134468274-134468296 CTTTATACAAAACTACAAGCAGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034912621 7:155009695-155009717 CTACTTACAAAGGTGTAGGCAGG - Intergenic
1036044104 8:5120390-5120412 CTTGATAGAAAAGTGCCGGCGGG - Intergenic
1036603005 8:10280217-10280239 CTTTATAGAAAGGTTCACGAAGG - Intronic
1037633739 8:20681002-20681024 CTTTATATAAAAGTCAAGGCCGG - Intergenic
1039856677 8:41421140-41421162 CTATATTCAAAGGTCCTGGCCGG - Intergenic
1040503115 8:48022430-48022452 CAATATAAAAAGATGCAGGCTGG - Intronic
1040662936 8:49596578-49596600 CCTTATACAAAGGAGGAGCCTGG + Intergenic
1042867105 8:73365784-73365806 CTTCAGACAAAAGGGCAGGCAGG + Intergenic
1046810365 8:118526585-118526607 CTATTTAGAAAGGTGCTGGCAGG + Intronic
1047480391 8:125276631-125276653 CTTTATTCAAAGGTTCATGGAGG - Intronic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1048473493 8:134723372-134723394 CTCTTTACAAAGGTGTGGGCAGG + Intergenic
1051343847 9:16135077-16135099 CTTTCTATAAAGTTCCAGGCAGG + Intergenic
1051740854 9:20250546-20250568 CTTTATAGCAGGGTCCAGGCTGG + Intergenic
1053837236 9:42152715-42152737 CAATATACTAAAGTGCAGGCCGG + Intergenic
1058126187 9:101197802-101197824 CTTTATACAAAGTTACAGACTGG + Intronic
1185777831 X:2819899-2819921 CTTCATACAAAGCTGCAGGGAGG + Intergenic
1191157306 X:57287674-57287696 CTCTATAGAATTGTGCAGGCAGG + Intronic
1195033181 X:100946516-100946538 CTATCTACAAAGGTGTGGGCAGG + Intergenic
1196938935 X:120756850-120756872 CTATTTATAAAGGTGTAGGCAGG - Intergenic
1197832589 X:130660522-130660544 GTTTGGACATAGGTGCAGGCAGG + Intronic
1198984217 X:142431009-142431031 CTTTATACAACAGTGCTGGAAGG + Intergenic