ID: 1068849297

View in Genome Browser
Species Human (GRCh38)
Location 10:61718231-61718253
Sequence ATGAAGCAAAGGTCAGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068849294_1068849297 23 Left 1068849294 10:61718185-61718207 CCATAAAATCAGTATGATTTTCC 0: 1
1: 0
2: 2
3: 27
4: 359
Right 1068849297 10:61718231-61718253 ATGAAGCAAAGGTCAGATTTTGG No data
1068849295_1068849297 2 Left 1068849295 10:61718206-61718228 CCATAAAGAGATTATTATTTTTG 0: 1
1: 0
2: 7
3: 78
4: 658
Right 1068849297 10:61718231-61718253 ATGAAGCAAAGGTCAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068849297 Original CRISPR ATGAAGCAAAGGTCAGATTT TGG Intronic
No off target data available for this crispr