ID: 1068853908

View in Genome Browser
Species Human (GRCh38)
Location 10:61777093-61777115
Sequence CTGGAGACAGACATTAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068853908_1068853911 -1 Left 1068853908 10:61777093-61777115 CCATGTTTAATGTCTGTCTCCAG No data
Right 1068853911 10:61777115-61777137 GCCCAGGCTGTAGCTCTAGAAGG No data
1068853908_1068853914 20 Left 1068853908 10:61777093-61777115 CCATGTTTAATGTCTGTCTCCAG No data
Right 1068853914 10:61777136-61777158 GGACAGAAACTGTTTCTATCTGG No data
1068853908_1068853915 25 Left 1068853908 10:61777093-61777115 CCATGTTTAATGTCTGTCTCCAG No data
Right 1068853915 10:61777141-61777163 GAAACTGTTTCTATCTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068853908 Original CRISPR CTGGAGACAGACATTAAACA TGG (reversed) Intergenic
No off target data available for this crispr