ID: 1068854682

View in Genome Browser
Species Human (GRCh38)
Location 10:61785343-61785365
Sequence TGAGTTGAAGTTGTCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068854682_1068854683 -6 Left 1068854682 10:61785343-61785365 CCTGGGCTGACAACTTCAACTCA No data
Right 1068854683 10:61785360-61785382 AACTCACCTAACCCTCTAACTGG No data
1068854682_1068854685 -4 Left 1068854682 10:61785343-61785365 CCTGGGCTGACAACTTCAACTCA No data
Right 1068854685 10:61785362-61785384 CTCACCTAACCCTCTAACTGGGG No data
1068854682_1068854684 -5 Left 1068854682 10:61785343-61785365 CCTGGGCTGACAACTTCAACTCA No data
Right 1068854684 10:61785361-61785383 ACTCACCTAACCCTCTAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068854682 Original CRISPR TGAGTTGAAGTTGTCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr