ID: 1068854685

View in Genome Browser
Species Human (GRCh38)
Location 10:61785362-61785384
Sequence CTCACCTAACCCTCTAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068854679_1068854685 13 Left 1068854679 10:61785326-61785348 CCTCACTTGTAAAGTTCCCTGGG No data
Right 1068854685 10:61785362-61785384 CTCACCTAACCCTCTAACTGGGG No data
1068854681_1068854685 -3 Left 1068854681 10:61785342-61785364 CCCTGGGCTGACAACTTCAACTC No data
Right 1068854685 10:61785362-61785384 CTCACCTAACCCTCTAACTGGGG No data
1068854682_1068854685 -4 Left 1068854682 10:61785343-61785365 CCTGGGCTGACAACTTCAACTCA No data
Right 1068854685 10:61785362-61785384 CTCACCTAACCCTCTAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068854685 Original CRISPR CTCACCTAACCCTCTAACTG GGG Intergenic
No off target data available for this crispr