ID: 1068859959

View in Genome Browser
Species Human (GRCh38)
Location 10:61838029-61838051
Sequence AGCTAGTTCTTTAAGTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068859953_1068859959 30 Left 1068859953 10:61837976-61837998 CCATCCATAACGACATTCACGGC No data
Right 1068859959 10:61838029-61838051 AGCTAGTTCTTTAAGTAAGGGGG No data
1068859955_1068859959 26 Left 1068859955 10:61837980-61838002 CCATAACGACATTCACGGCAGGA No data
Right 1068859959 10:61838029-61838051 AGCTAGTTCTTTAAGTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068859959 Original CRISPR AGCTAGTTCTTTAAGTAAGG GGG Intergenic
No off target data available for this crispr