ID: 1068860804

View in Genome Browser
Species Human (GRCh38)
Location 10:61846037-61846059
Sequence TTCCTATACTTCTCGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068860804_1068860809 5 Left 1068860804 10:61846037-61846059 CCTCCCACCGAGAAGTATAGGAA No data
Right 1068860809 10:61846065-61846087 TTATTAGACCACGGCTCTGTAGG No data
1068860804_1068860812 22 Left 1068860804 10:61846037-61846059 CCTCCCACCGAGAAGTATAGGAA No data
Right 1068860812 10:61846082-61846104 TGTAGGCCAACACCAGCACAGGG No data
1068860804_1068860811 21 Left 1068860804 10:61846037-61846059 CCTCCCACCGAGAAGTATAGGAA No data
Right 1068860811 10:61846081-61846103 CTGTAGGCCAACACCAGCACAGG No data
1068860804_1068860808 -4 Left 1068860804 10:61846037-61846059 CCTCCCACCGAGAAGTATAGGAA No data
Right 1068860808 10:61846056-61846078 GGAATGTTGTTATTAGACCACGG No data
1068860804_1068860813 26 Left 1068860804 10:61846037-61846059 CCTCCCACCGAGAAGTATAGGAA No data
Right 1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG No data
1068860804_1068860814 27 Left 1068860804 10:61846037-61846059 CCTCCCACCGAGAAGTATAGGAA No data
Right 1068860814 10:61846087-61846109 GCCAACACCAGCACAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068860804 Original CRISPR TTCCTATACTTCTCGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr