ID: 1068860807

View in Genome Browser
Species Human (GRCh38)
Location 10:61846044-61846066
Sequence AACAACATTCCTATACTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068860807_1068860811 14 Left 1068860807 10:61846044-61846066 CCGAGAAGTATAGGAATGTTGTT No data
Right 1068860811 10:61846081-61846103 CTGTAGGCCAACACCAGCACAGG No data
1068860807_1068860813 19 Left 1068860807 10:61846044-61846066 CCGAGAAGTATAGGAATGTTGTT No data
Right 1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG No data
1068860807_1068860812 15 Left 1068860807 10:61846044-61846066 CCGAGAAGTATAGGAATGTTGTT No data
Right 1068860812 10:61846082-61846104 TGTAGGCCAACACCAGCACAGGG No data
1068860807_1068860814 20 Left 1068860807 10:61846044-61846066 CCGAGAAGTATAGGAATGTTGTT No data
Right 1068860814 10:61846087-61846109 GCCAACACCAGCACAGGGCTGGG No data
1068860807_1068860809 -2 Left 1068860807 10:61846044-61846066 CCGAGAAGTATAGGAATGTTGTT No data
Right 1068860809 10:61846065-61846087 TTATTAGACCACGGCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068860807 Original CRISPR AACAACATTCCTATACTTCT CGG (reversed) Intergenic
No off target data available for this crispr