ID: 1068860810

View in Genome Browser
Species Human (GRCh38)
Location 10:61846073-61846095
Sequence GGTGTTGGCCTACAGAGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068860810_1068860817 25 Left 1068860810 10:61846073-61846095 CCACGGCTCTGTAGGCCAACACC No data
Right 1068860817 10:61846121-61846143 AGAGCCCTCAGAATCACCTGTGG No data
1068860810_1068860814 -9 Left 1068860810 10:61846073-61846095 CCACGGCTCTGTAGGCCAACACC No data
Right 1068860814 10:61846087-61846109 GCCAACACCAGCACAGGGCTGGG No data
1068860810_1068860813 -10 Left 1068860810 10:61846073-61846095 CCACGGCTCTGTAGGCCAACACC No data
Right 1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068860810 Original CRISPR GGTGTTGGCCTACAGAGCCG TGG (reversed) Intergenic
No off target data available for this crispr