ID: 1068860813

View in Genome Browser
Species Human (GRCh38)
Location 10:61846086-61846108
Sequence GGCCAACACCAGCACAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068860807_1068860813 19 Left 1068860807 10:61846044-61846066 CCGAGAAGTATAGGAATGTTGTT No data
Right 1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG No data
1068860810_1068860813 -10 Left 1068860810 10:61846073-61846095 CCACGGCTCTGTAGGCCAACACC No data
Right 1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG No data
1068860804_1068860813 26 Left 1068860804 10:61846037-61846059 CCTCCCACCGAGAAGTATAGGAA No data
Right 1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG No data
1068860806_1068860813 22 Left 1068860806 10:61846041-61846063 CCACCGAGAAGTATAGGAATGTT No data
Right 1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG No data
1068860805_1068860813 23 Left 1068860805 10:61846040-61846062 CCCACCGAGAAGTATAGGAATGT No data
Right 1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068860813 Original CRISPR GGCCAACACCAGCACAGGGC TGG Intergenic
No off target data available for this crispr