ID: 1068863687

View in Genome Browser
Species Human (GRCh38)
Location 10:61872178-61872200
Sequence CTGTATCCTCACATGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068863681_1068863687 9 Left 1068863681 10:61872146-61872168 CCATGTTCTGGTTCATAGATAGT No data
Right 1068863687 10:61872178-61872200 CTGTATCCTCACATGGGGAAAGG No data
1068863680_1068863687 10 Left 1068863680 10:61872145-61872167 CCCATGTTCTGGTTCATAGATAG No data
Right 1068863687 10:61872178-61872200 CTGTATCCTCACATGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068863687 Original CRISPR CTGTATCCTCACATGGGGAA AGG Intergenic
No off target data available for this crispr