ID: 1068875858

View in Genome Browser
Species Human (GRCh38)
Location 10:61996013-61996035
Sequence CTACAGGCACAGCTGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 383}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068875858_1068875869 15 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875869 10:61996051-61996073 AAGGAGGTTGATGAAAGGTAGGG No data
1068875858_1068875868 14 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875868 10:61996050-61996072 GAAGGAGGTTGATGAAAGGTAGG No data
1068875858_1068875867 10 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875867 10:61996046-61996068 TGTGGAAGGAGGTTGATGAAAGG No data
1068875858_1068875871 23 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875871 10:61996059-61996081 TGATGAAAGGTAGGGGTTCTAGG No data
1068875858_1068875870 16 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875870 10:61996052-61996074 AGGAGGTTGATGAAAGGTAGGGG No data
1068875858_1068875864 -4 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875864 10:61996032-61996054 GTAGCCTCTTAGTGTGTGGAAGG No data
1068875858_1068875862 -8 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875862 10:61996028-61996050 GCCTGTAGCCTCTTAGTGTGTGG No data
1068875858_1068875865 -1 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875865 10:61996035-61996057 GCCTCTTAGTGTGTGGAAGGAGG No data
1068875858_1068875872 27 Left 1068875858 10:61996013-61996035 CCAAGCCCCAGCTGTGCCTGTAG 0: 1
1: 0
2: 6
3: 40
4: 383
Right 1068875872 10:61996063-61996085 GAAAGGTAGGGGTTCTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068875858 Original CRISPR CTACAGGCACAGCTGGGGCT TGG (reversed) Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900385768 1:2409932-2409954 CTACATGCTGAGCTGGGGTTGGG + Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900551380 1:3257909-3257931 CCACAGGGACAGCTGTGTCTAGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900716567 1:4148838-4148860 CACCATGCACAGCTGGGTCTTGG - Intergenic
900952808 1:5867470-5867492 CTCCAGGCACACCTGGACCTGGG + Intronic
901314311 1:8295468-8295490 CGTCAGGCACAGCTGCTGCTGGG + Intergenic
901737912 1:11323962-11323984 TGCCTGGCACAGCTGGGGCTGGG + Intergenic
901786953 1:11631011-11631033 CTTCAAGCACTGCTTGGGCTTGG + Intergenic
902200517 1:14830123-14830145 CTTCAGGCACAGCTGGATCCAGG + Intronic
902556792 1:17251497-17251519 TTACAGGCACTGCTGGGGAGTGG - Intronic
902648798 1:17823132-17823154 CTACGGGCATAGCTGGGGCCAGG - Exonic
902675507 1:18005922-18005944 TTAGAGGCAGAGCCGGGGCTGGG + Intergenic
902687102 1:18085311-18085333 CTGCAGGCTCAGCTGAGGATTGG + Intergenic
902721443 1:18306911-18306933 CTCCAGGCACAGCCAGGACTGGG + Intronic
902749458 1:18497321-18497343 CTCTAGGCTCAGCTGCGGCTGGG + Intergenic
902807901 1:18872300-18872322 CTACTGGCCCAGGTGGGTCTGGG + Exonic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903863259 1:26378523-26378545 CCACAGGCAGAGCTGAGGGTGGG + Intergenic
904275605 1:29382182-29382204 CTACAGTCAAAGCTTAGGCTTGG + Intergenic
904799770 1:33084086-33084108 GTTCTGGCCCAGCTGGGGCTGGG + Exonic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
910123518 1:83816018-83816040 CTCCATGTACAGCTGGGGCTGGG - Intergenic
911371945 1:97004367-97004389 CTGCATGAATAGCTGGGGCTGGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912471888 1:109911872-109911894 CTACCGCCACAGTTGGGGCAGGG - Intronic
912678198 1:111705913-111705935 CTCCAGGCTCCGGTGGGGCTGGG + Intronic
915018090 1:152755426-152755448 CCACATGCACAGCTGGGTCATGG + Intronic
915185080 1:154098630-154098652 CTCCAGGCTCAGCCGGAGCTGGG - Intronic
916715450 1:167443347-167443369 GGGCAGGCACACCTGGGGCTGGG - Intronic
919803772 1:201368786-201368808 CTACAGGCACAGCCCAGGCCAGG - Intronic
922012145 1:221599573-221599595 CAACTGGCACAGCTGGCACTGGG - Intergenic
922291630 1:224213504-224213526 CCACTGGCACCGCTGGGCCTAGG - Intergenic
922707446 1:227796786-227796808 CTACAGAGACAGCCTGGGCTAGG - Intergenic
923022395 1:230175035-230175057 CTAGAGACACAGCAGGGGCCAGG - Intronic
923314206 1:232763879-232763901 CTACAGAAACAGCAGGGGTTTGG - Intergenic
923445569 1:234067717-234067739 CTGGAGGCTCAGCTCGGGCTAGG - Intronic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
1062793425 10:323973-323995 CTACAGGCAGAGCTGGTCTTTGG - Intronic
1062878662 10:961257-961279 ATAAAGGCACACCTGAGGCTGGG + Intergenic
1063648841 10:7913213-7913235 ATACAGGCACACAGGGGGCTAGG + Intronic
1063980557 10:11448397-11448419 CTACAGCCCGAGGTGGGGCTGGG + Intergenic
1068006313 10:51395472-51395494 CCAGAGGTAAAGCTGGGGCTGGG + Intronic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069510376 10:69037706-69037728 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1070723664 10:78773601-78773623 CTCCAGGAAGAGCTGGAGCTTGG - Intergenic
1070782681 10:79146702-79146724 ACACAGGCAGGGCTGGGGCTGGG + Intronic
1071389236 10:85154276-85154298 CCAGAGGCACAGCTGGGCCAGGG - Intergenic
1071727667 10:88216333-88216355 CTTCAGGCACAGCTGGATCTAGG + Intergenic
1072310508 10:94149828-94149850 CTTCAGAGACAGCAGGGGCTGGG + Intronic
1074043940 10:109819731-109819753 CTATAGGCAGAGCTGGAACTAGG + Intergenic
1074701151 10:116093631-116093653 CAAGAGGTACAGCTGGAGCTCGG + Intronic
1074867992 10:117555941-117555963 GTAAAAGCACAGCTAGGGCTGGG + Intergenic
1076926615 10:133493586-133493608 ATAAAGGAATAGCTGGGGCTGGG + Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077179331 11:1205156-1205178 ATACAGGCACACCTGGGGGCAGG - Intergenic
1077319641 11:1935500-1935522 CCGCAGGCAAAGCTGGGACTGGG + Intronic
1078617966 11:12882435-12882457 CTACACACACAGGTGGGGATGGG - Intronic
1078847129 11:15128524-15128546 TTACTGGCAGAGCTGGGGCTAGG + Intronic
1078903218 11:15660929-15660951 CTATGGGAAGAGCTGGGGCTGGG - Intergenic
1079027658 11:16961538-16961560 CTCCAGGCACAGCCAGGGGTGGG - Intronic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1080282587 11:30575569-30575591 CAAAAGGCACAGCTTGGGCTGGG - Intronic
1080690221 11:34550002-34550024 CTGCAGGAGCAGCTGGGGATTGG + Intergenic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1084164771 11:67370416-67370438 CCAGAGGCAGAGCTGGGGCGGGG - Intronic
1084406921 11:68979532-68979554 CTTCAGGCACACCTGGGGAAAGG + Intergenic
1084435561 11:69137280-69137302 GTCCAGGGAGAGCTGGGGCTTGG + Intergenic
1084891361 11:72238640-72238662 CCACAGGCACCCCTGGGGCTGGG - Exonic
1084938977 11:72602256-72602278 GAACAGGGACAGGTGGGGCTGGG + Intronic
1089834050 11:121354370-121354392 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1090044320 11:123317434-123317456 CTAATGCCTCAGCTGGGGCTAGG + Intergenic
1090239722 11:125173633-125173655 CTTCAGTCTCAGGTGGGGCTGGG + Intronic
1092382787 12:8011499-8011521 CTACAGGCACTGTTGGTGCCTGG - Intergenic
1092534133 12:9371828-9371850 ATACAGGGAAAGCTGGTGCTGGG - Intergenic
1092861725 12:12724837-12724859 CTGCGGGCCCAGCTGGGGGTGGG + Intergenic
1092929643 12:13303764-13303786 TTTCAGGCACAGCTGGATCTAGG + Intergenic
1096910794 12:54981850-54981872 CTAAAGGCAAACCTGGGACTGGG - Intronic
1097233823 12:57526903-57526925 CTTCAGGCTCTCCTGGGGCTAGG - Exonic
1097870637 12:64599188-64599210 CTAGAAGCAGAGCTGAGGCTGGG - Intergenic
1098889573 12:75995619-75995641 CTACAGGGACAGATGGGGTGGGG - Intergenic
1099038361 12:77618143-77618165 CTGAAGGCTCAACTGGGGCTGGG - Intergenic
1099044348 12:77697208-77697230 CTACAGGCCAAGGTAGGGCTGGG - Intergenic
1101376904 12:104179007-104179029 CTTCAGGCACAGCTTGATCTAGG - Intergenic
1101897831 12:108769244-108769266 CAACAGACAGATCTGGGGCTGGG + Intergenic
1101966280 12:109284387-109284409 GCATAGGCAGAGCTGGGGCTGGG + Intronic
1102111792 12:110370807-110370829 CTCCAGGCACGGCTGTGGCCAGG - Intergenic
1102560381 12:113757815-113757837 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1103405796 12:120674428-120674450 CTACAGGCACAGCAGGATCAGGG - Intergenic
1103587796 12:121969028-121969050 CCACAGGCAGCGCAGGGGCTTGG - Intronic
1103845692 12:123900710-123900732 CTTCAGGCACAGCTGGATCTAGG + Intronic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1104377415 12:128277259-128277281 CTTCAGGCACAGCTGGATCCAGG + Intronic
1104517978 12:129445613-129445635 CTTCAGGCACAGCTGGATCCAGG - Intronic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104891139 12:132140736-132140758 CTACAGGGACGGCAGGGGGTCGG + Intronic
1104947627 12:132423623-132423645 CTGCAGGCGGAGCAGGGGCTGGG + Intergenic
1105432611 13:20350954-20350976 CATCAGGCGCTGCTGGGGCTGGG + Intergenic
1106758172 13:32842943-32842965 CTGAAGGCTCAGCTGGGGTTGGG - Intergenic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1108510207 13:51148801-51148823 ATACGGGCCCAGCTGGGGCCTGG - Intergenic
1108521093 13:51247516-51247538 CCACATGCACACCTGGGGGTGGG + Intronic
1108869986 13:54973019-54973041 CAAGAGGCACAGCTGGGCCAGGG + Intergenic
1109075855 13:57833322-57833344 CTAAAGGAACACCTGAGGCTGGG - Intergenic
1109359839 13:61281633-61281655 TGACAGGCACATCTAGGGCTAGG - Intergenic
1112805168 13:103156789-103156811 GTGCAGGCAAAGCTGGGGCAGGG - Intergenic
1113388905 13:109876472-109876494 CCACAGGCTCTGCTGGGACTTGG + Intergenic
1113764041 13:112869802-112869824 CTCTAGGAACAGCTGTGGCTTGG - Intronic
1113812968 13:113153490-113153512 CAGCAGGCACAGCTGGGTCCAGG + Intergenic
1113847183 13:113399087-113399109 CCACGGGCACAGCAGGGGTTTGG + Intergenic
1113978657 13:114252373-114252395 GTACAGGCACAGTAGGGGTTAGG + Intronic
1117285613 14:54283115-54283137 GGGGAGGCACAGCTGGGGCTGGG - Intergenic
1118648753 14:67867745-67867767 GTCCAGAAACAGCTGGGGCTGGG - Intronic
1118807461 14:69250557-69250579 ACACAGGCCCAGGTGGGGCTGGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119507694 14:75187104-75187126 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
1121333309 14:93061433-93061455 CCATGGGCACAGCTGCGGCTAGG + Intronic
1122099360 14:99394874-99394896 CAAAAGGCACAGCTAGGGCCAGG - Intergenic
1122125495 14:99576431-99576453 CTCCAGGCAGAGCTGAGGGTGGG - Intronic
1122314207 14:100816020-100816042 TTTCAGGAACAGCTGAGGCTGGG + Intergenic
1122862016 14:104586962-104586984 CCACAGGCACAGCAGGAGCTGGG + Intronic
1124018860 15:25902110-25902132 CTGCAGGCTCATCTGAGGCTGGG - Intergenic
1124443441 15:29707082-29707104 CTACAGCCAGAGCGGGCGCTTGG - Intronic
1125323720 15:38515203-38515225 TTACAGTCAAAGCTGGGGCTAGG - Intronic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1126921909 15:53536075-53536097 CAAGAGGCACAGCTGGGACTTGG + Intronic
1127390272 15:58499687-58499709 GGACAGGCAGAGCTGGGGCCTGG - Intronic
1129676358 15:77634053-77634075 CCACAGGGGCAGCTGAGGCTGGG + Intronic
1129882012 15:79013214-79013236 TTACATACAAAGCTGGGGCTGGG + Intronic
1130234095 15:82118155-82118177 CTACAGCCTCTGCTGGGGTTGGG - Intergenic
1130573682 15:85071630-85071652 CAACAAGCACAGTTCGGGCTTGG - Intronic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1131537871 15:93252656-93252678 GTTCAGGCACAGCTGGATCTAGG - Intergenic
1132464904 16:72783-72805 CTGCGGGGACACCTGGGGCTGGG + Intronic
1132631173 16:918307-918329 CCACAGGGACACCTGGGGCTAGG - Intronic
1132725502 16:1336601-1336623 CCACAGACACAGCAGGGGCCCGG + Intronic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1133237031 16:4392226-4392248 CAACCGGCCCAGCTGGGGCTGGG - Intronic
1133896079 16:9930174-9930196 CTAGAGGCACAGCTTGATCTAGG - Intronic
1136429080 16:30186575-30186597 CTAAAGGCACAGCAGGGCCTTGG - Intronic
1138137157 16:54533048-54533070 CTACATTCACATCAGGGGCTAGG + Intergenic
1138246672 16:55471896-55471918 CTACAGGCAGGGCTGGGTCCAGG + Intronic
1138447285 16:57072099-57072121 CTTCAGGCACAGCTGGATCCAGG + Intronic
1139491536 16:67288640-67288662 TCACAGGCTCAGCTTGGGCTGGG - Intronic
1139777230 16:69324118-69324140 CAACAGGCGCAGCTGAGGGTGGG - Intronic
1140349423 16:74247909-74247931 TTCCAGGCACAGCTGAGGGTAGG - Intergenic
1140710152 16:77670267-77670289 ATACAGTCACAGTGGGGGCTGGG - Intergenic
1141618855 16:85225915-85225937 CTGAAGGCTCTGCTGGGGCTGGG + Intergenic
1141865780 16:86748842-86748864 GTTCAGGGACAGCTGTGGCTGGG + Intergenic
1142126430 16:88412920-88412942 CCACAGCCACAGCCGGGGCCCGG + Intergenic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144782741 17:17816086-17816108 CTCCAGGCCAAGCTGGGACTCGG - Intronic
1145053567 17:19682918-19682940 CTACAGGCACAGCTCATCCTTGG + Intronic
1145277347 17:21440514-21440536 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145315185 17:21726409-21726431 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145322469 17:21774390-21774412 CTTCAGGGCTAGCTGGGGCTGGG - Intergenic
1145713616 17:26998345-26998367 CTTCAGGGACAGCTGGTGGTAGG + Intergenic
1145776107 17:27530163-27530185 CTAAAGACCCAGCAGGGGCTGGG + Intronic
1146660984 17:34665035-34665057 ATAAAGGAACAGCTGGCGCTGGG + Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147818046 17:43224344-43224366 CCACAGGCACAGGTGTGGCCAGG - Intergenic
1149491898 17:57091184-57091206 CTAAAGGCACAGCTGAGTGTGGG - Intronic
1150216926 17:63476457-63476479 CGGCCGGCACACCTGGGGCTTGG - Intergenic
1151170214 17:72239398-72239420 CTCAAGGCACAGCTGGGGTGGGG + Intergenic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152366620 17:79860212-79860234 TGGCAGGCGCAGCTGGGGCTTGG + Intergenic
1153953782 18:10078801-10078823 CCAAAGGCACTGCTGTGGCTAGG - Intergenic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1156508568 18:37615771-37615793 CTGCAGGAGCAGCTGGGACTTGG + Intergenic
1157623417 18:49029147-49029169 CTCCAGGCACTTCTGAGGCTGGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160515241 18:79475977-79475999 CGACGGGCGCACCTGGGGCTGGG + Intronic
1160833512 19:1113970-1113992 TCAGAGGCAGAGCTGGGGCTTGG - Intronic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1160855543 19:1215552-1215574 CTGCAGGCTGTGCTGGGGCTGGG - Intronic
1160938169 19:1607454-1607476 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1161067938 19:2247723-2247745 CAGCAGGCACGGGTGGGGCTAGG - Intronic
1161341775 19:3746925-3746947 GTGCAGGCCCAGCTGGGGTTTGG + Intronic
1161455179 19:4366376-4366398 CTTCAGGCACAGCTGGATCCCGG - Intronic
1161569794 19:5024271-5024293 GCACTGGCACTGCTGGGGCTGGG - Intronic
1161981670 19:7633277-7633299 CTACAGCCACAACTGGGTCAGGG + Intronic
1162496879 19:11028313-11028335 CTTCAGGCACAGCTGGATCCAGG + Intronic
1162928368 19:13942223-13942245 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163668893 19:18616237-18616259 CTTCAGGCACAGCTGGATCCAGG + Intronic
1163821863 19:19500577-19500599 CTACAGGGGCAGCAAGGGCTTGG - Intronic
1164561358 19:29294324-29294346 CTTCAGGGCCAGCTGGGGCAAGG - Intergenic
1164678764 19:30120238-30120260 CTTCAGGCACAGCTGGATCCAGG - Intergenic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1165073108 19:33267035-33267057 CTTCAGGCAAACTTGGGGCTCGG + Intergenic
1165927489 19:39335934-39335956 CTATGGGAAGAGCTGGGGCTGGG - Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1167097180 19:47380734-47380756 CTTCAGGCACAGCTGGATCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
924963593 2:56837-56859 CTCGAGGCAGAGCTGGGCCTGGG + Intergenic
925571023 2:5312807-5312829 AGACAGGCAGAGCTGGGACTGGG + Intergenic
925712479 2:6754634-6754656 CTAGAGGCAGAGCTGGGATTAGG + Intergenic
927149020 2:20185266-20185288 CTTCAGGCACAGCTGGAAGTGGG - Intergenic
927150143 2:20190929-20190951 CTTCAGGCACAGATGAGACTTGG - Intergenic
927847848 2:26480506-26480528 CCACAGGGACAGCCGTGGCTGGG + Intronic
927888345 2:26732068-26732090 CTAGAGGGACAGCTCAGGCTTGG + Exonic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
929314871 2:40464982-40465004 GTTCTGGCACAGCTGGGGGTGGG - Intronic
930016182 2:46972067-46972089 CTTCAGGCAAAGCTGGATCTAGG + Intronic
930216044 2:48698633-48698655 CTAAAAGCACAGCAGTGGCTGGG + Exonic
931465047 2:62478437-62478459 CTGCATGCAGAGCTTGGGCTGGG - Intergenic
932592162 2:73074083-73074105 CTACAAGCAAACCAGGGGCTGGG + Exonic
932752784 2:74382101-74382123 CTACAGGAAGAGCAGGGCCTTGG - Intronic
934204061 2:89910665-89910687 CTCCAGGCAGAGCAGGAGCTGGG - Intergenic
934659678 2:96136580-96136602 CTCAAGGCTCAGCTGGCGCTGGG + Intronic
934953873 2:98600192-98600214 CCACAGGCATAGCTGATGCTAGG - Exonic
935860123 2:107320566-107320588 CTACAGTCACAGCTGTCTCTGGG - Intergenic
936092090 2:109507994-109508016 CTTCAGGCATAGCTGGGTCCAGG + Intergenic
937413503 2:121696653-121696675 GAAGAGGAACAGCTGGGGCTGGG + Intergenic
938540491 2:132280485-132280507 CAACAGGCATTCCTGGGGCTTGG + Intergenic
940517139 2:154697425-154697447 CTGCAGGCTCAACTGAGGCTCGG + Intergenic
940957051 2:159739162-159739184 CTACAGCCACAGCTGGGTCAGGG + Intronic
941178451 2:162230007-162230029 TTTCAGGCACAGATTGGGCTGGG + Intronic
943535294 2:189141117-189141139 TGACAGGCAGAGATGGGGCTGGG + Intronic
944022796 2:195126062-195126084 CCGCAGCCTCAGCTGGGGCTTGG + Intergenic
944279090 2:197873649-197873671 ATACAGCCAAAGCTGGGGGTGGG + Intronic
945178311 2:207065814-207065836 CCAGAGGCACAGCTAGAGCTAGG + Intergenic
946268372 2:218568473-218568495 CTACAGTCACGGCAGGGGCGGGG - Intergenic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
947769989 2:232662873-232662895 CTTCAGGCCCAGGTGGGTCTGGG - Exonic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
947894563 2:233657273-233657295 CTAAAGGAATACCTGGGGCTGGG + Intronic
948210818 2:236191889-236191911 CTAAAGGAACAGCTGAGGCCGGG - Intergenic
948897227 2:240933123-240933145 CTGCAGGCACAGCTCCTGCTCGG - Intronic
1170536464 20:17345854-17345876 GTAAAGGAGCAGCTGGGGCTGGG + Intronic
1171199997 20:23233171-23233193 CAGCAGTCACAGCTGGGGTTGGG - Intergenic
1171358988 20:24573382-24573404 GCACAGGCAAAGCTGGGGGTAGG - Intronic
1171457873 20:25282155-25282177 CCACAGGCACGGGTGGGGCCCGG - Intronic
1172477928 20:35252813-35252835 GGACAGGCTCAGGTGGGGCTGGG + Intronic
1173455634 20:43199154-43199176 CTTCAGGCAAAGCTGGATCTAGG + Intergenic
1173850722 20:46216233-46216255 CTGCTGGCACAGCGGGGGTTGGG - Intronic
1174078516 20:47954733-47954755 CTACAGGCACAGCTGGATCTTGG - Intergenic
1174134614 20:48370870-48370892 CTACAGGAGAAGCTGGGCCTTGG + Intergenic
1175069692 20:56322782-56322804 CTCCAGGCACCACTGGGGCTGGG + Intergenic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175221993 20:57422508-57422530 CTAAAGGCACAGTGGGGGATGGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175315259 20:58042924-58042946 GTACAGGCAGATGTGGGGCTGGG + Intergenic
1175715670 20:61252972-61252994 CTTCAGCCACGGCCGGGGCTGGG - Intronic
1175728951 20:61339769-61339791 CTGCAGGCATCGCTGGGGATTGG + Intronic
1175891170 20:62316676-62316698 CTCCAGGAACAGCAGAGGCTGGG - Exonic
1176008144 20:62877246-62877268 CCACTGGCACTGCTGGGTCTGGG + Intergenic
1176119806 20:63449200-63449222 CTTCAGGCACAGCTGGATCCAGG - Intronic
1176161146 20:63649466-63649488 CCACAGACACAGCTGGTGCCAGG + Intronic
1176358125 21:5969663-5969685 CCAGAGGAACAGCTGGTGCTGGG + Intergenic
1177165633 21:17599773-17599795 TTATAAGTACAGCTGGGGCTGGG - Intronic
1177971801 21:27799159-27799181 ATAAGGGCACTGCTGGGGCTAGG + Intergenic
1178692327 21:34760334-34760356 CTATGGGCTCAGCTGGGGCATGG - Intergenic
1178935036 21:36854362-36854384 AGACAGGCACATCTGGGGCACGG + Intronic
1179261631 21:39763152-39763174 CTTGAGGCACAGCTGCGGCGTGG + Intronic
1179354053 21:40642151-40642173 GTACTGGCACAGCTGGGCCCTGG + Intronic
1179765393 21:43568888-43568910 CCAGAGGAACAGCTGGTGCTGGG - Intronic
1179886374 21:44315937-44315959 GCACACACACAGCTGGGGCTGGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1182756547 22:32684364-32684386 CTTCAGGCACAGCTGGATCTAGG - Intronic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183311459 22:37112145-37112167 CTCCAGGCAGAGCCAGGGCTGGG + Intergenic
1183541025 22:38429533-38429555 CTACGGGGACAGCAGGTGCTGGG + Intronic
1183867014 22:40712027-40712049 CTACAGGCACAGTTGCCTCTAGG + Intergenic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184386643 22:44180332-44180354 ATAAAGGGACAGCTGGGGCAGGG - Intronic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
1185299215 22:50070725-50070747 CCAAAGGCGCAGCTGGGGCAGGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949777698 3:7650979-7651001 TTACAGTCAGAGCTGGGGTTTGG - Intronic
949921821 3:9009049-9009071 CTTCAGGCACAGCTGGATCCAGG - Intronic
949969939 3:9396543-9396565 CTACAGGCACTCGTGGGGGTGGG - Intergenic
950006629 3:9695688-9695710 GTTGAGGCACAGCTGGGGCTGGG - Intronic
950047814 3:9960879-9960901 CTTCAGGCACAGCTGGGTCCAGG - Intergenic
950132761 3:10558578-10558600 CTTCAGGCACAGCTGGATCCAGG - Intronic
950585764 3:13890921-13890943 CTAAAGGCAGAGGTGTGGCTGGG - Intergenic
952968054 3:38633131-38633153 CTGCAGGTCCAGCTGGGGCCGGG + Exonic
953565937 3:44032174-44032196 CGCCAGGCACAGCTAGGGTTTGG - Intergenic
953675963 3:45002793-45002815 CTAGTGGCACAGCTAGGGGTGGG - Intronic
954090820 3:48282678-48282700 CTACATGCAGAGCTGGCGCATGG + Intronic
954315430 3:49798871-49798893 AGACAGTCACACCTGGGGCTCGG - Exonic
955238567 3:57160997-57161019 CCCCAGGCACTGCAGGGGCTTGG + Intronic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957005654 3:74943675-74943697 CTTCAGGCACAGCTGTGTCCAGG - Intergenic
959342663 3:105150084-105150106 ATAAAGGCACACCTGAGGCTGGG + Intergenic
961515315 3:127428752-127428774 CTTCAGGCACAGCTGGATCCAGG + Intergenic
961644906 3:128387723-128387745 CTACAGGCTCCACTGGGGCTGGG + Intronic
961741285 3:129034580-129034602 CTTCAGGCACAGCTGGGTCCAGG + Intronic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963599902 3:147369846-147369868 CCACAGGCTCAGCTGCGGCGCGG + Intergenic
965616318 3:170596384-170596406 CTTCAGGCATAGCTGGGTCCAGG + Intronic
966191589 3:177276774-177276796 TAAGAGGCAGAGCTGGGGCTTGG - Intergenic
967075315 3:185996577-185996599 CAAAAGGCACAACAGGGGCTAGG + Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968479804 4:828056-828078 CTCCAAGCACACCTGGAGCTGGG + Intergenic
968545452 4:1195500-1195522 CTCCAGGCACAGCTCGAGGTTGG + Intronic
969081658 4:4623515-4623537 CTAAAGGCACACCTGAGACTGGG - Intergenic
969245152 4:5927152-5927174 CTCCAGGCACAGCTGGCTCCAGG - Intronic
969442459 4:7225588-7225610 GTTCAGGCCCAGCTGGGGGTTGG + Intronic
969868978 4:10093214-10093236 GTACAGGGTCAGCTGAGGCTGGG - Intronic
970599938 4:17633731-17633753 GTCCGGCCACAGCTGGGGCTTGG + Exonic
971033204 4:22663639-22663661 CGCATGGCACAGCTGGGGCTTGG + Intergenic
971377204 4:26064538-26064560 CTTCAGGCACAGCTGGTGAGAGG - Intergenic
971540354 4:27808424-27808446 ATAAAGGGACAGCTGGGGCTGGG - Intergenic
972063329 4:34909247-34909269 ATAAAGACACACCTGGGGCTGGG - Intergenic
975543991 4:75543358-75543380 CTTCAGGTACAGCTGGATCTAGG + Intronic
975618334 4:76270108-76270130 CTTCAGGCACAGCTGGATCCAGG + Intronic
977241255 4:94572715-94572737 ATACAGACACAGATGGGGCATGG + Intronic
977928627 4:102728861-102728883 CCAGAGCCAAAGCTGGGGCTTGG + Intronic
978499592 4:109394489-109394511 GAACAGGCAAAGCTGTGGCTTGG - Intergenic
980972035 4:139575873-139575895 CCACAGGCAGAGCTGGCCCTTGG - Intronic
981616494 4:146648845-146648867 CTACAGCCAATTCTGGGGCTGGG - Intergenic
984293265 4:177822239-177822261 CTCCAGCCTCAGATGGGGCTTGG + Intronic
984483082 4:180330599-180330621 CTAAAGGAACAGCATGGGCTGGG - Intergenic
985130634 4:186735100-186735122 CTGAAGGTACAGCTAGGGCTGGG - Intergenic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
986639875 5:9861820-9861842 CTTCAGGCTGAGCTGGGGCTAGG - Intergenic
986859292 5:11906463-11906485 CTACAGATACTGTTGGGGCTGGG + Intergenic
987812002 5:22849088-22849110 CTACAGCCACAGCTGGAACATGG - Intronic
988439611 5:31217780-31217802 ATAGAGGCAGAGCTGGGCCTGGG - Intronic
988618894 5:32802359-32802381 CTAGTGGCAGAGCTGGGGTTTGG + Intergenic
989253516 5:39342656-39342678 CTACAGGAATGGCTGGGCCTGGG - Intronic
992603277 5:78427051-78427073 CTAAAGGAACACCTGAGGCTGGG + Intronic
994041215 5:95261913-95261935 CTACAGGGAGCTCTGGGGCTGGG + Intronic
995965543 5:117903179-117903201 TTACTGGCACAGCTGAAGCTTGG - Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997929539 5:138060974-138060996 CTAAAGGCAGAGCTGAGCCTGGG + Intergenic
998063231 5:139135525-139135547 CCACAGGCCCAGCTGGGAATAGG + Intronic
998512969 5:142729002-142729024 CTACAGGCACAGCTGAAGGATGG - Intergenic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999500313 5:152140553-152140575 CTACAGGCATGGCTGGATCTAGG + Intergenic
1000300010 5:159947935-159947957 ATCCAGGGACAGCTGGAGCTTGG - Intronic
1001050661 5:168411524-168411546 CTTCAGGCACAGCTGGATCCAGG + Intronic
1001452817 5:171839273-171839295 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002082745 5:176747358-176747380 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1002316560 5:178348045-178348067 CGAGGGGCACTGCTGGGGCTGGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1003482398 6:6545934-6545956 CTCCAGGCTGAGCTGGGGGTGGG + Intergenic
1003623737 6:7725290-7725312 CTCCAGGAAGAGCAGGGGCTTGG - Intergenic
1004442722 6:15669470-15669492 CTCCAGGCACAGTTGGTTCTTGG - Intergenic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006402318 6:33825015-33825037 CTGCAGGCACTGCTGGGTTTGGG + Intergenic
1006442833 6:34062793-34062815 TGAGAGGCACATCTGGGGCTGGG - Intronic
1007609389 6:43139430-43139452 CTCCATGCACTGCTGTGGCTGGG - Exonic
1007697645 6:43743953-43743975 TTCCTGGCACAGCTGGGCCTGGG - Intergenic
1009645608 6:66396605-66396627 CTCCATGCACAGCTATGGCTGGG - Intergenic
1012506479 6:99952082-99952104 CCACAGGCACAGCAGGCCCTGGG - Intronic
1014395354 6:120921745-120921767 TTACAGGAACACCTGAGGCTGGG + Intergenic
1016170407 6:141007510-141007532 CTAGAGGGTCAGCTGTGGCTTGG - Intergenic
1017339673 6:153305653-153305675 ATAAAGGAACACCTGGGGCTGGG - Intergenic
1019598276 7:1868513-1868535 GTACAGGCTCAGCAGGGGGTGGG + Intronic
1021866431 7:24962743-24962765 CTTCAGGCACGGCTGGACCTAGG - Intronic
1022487901 7:30794495-30794517 CTAGGGGCACAGGTGGGGTTAGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1025057995 7:55780492-55780514 ATCCAGGCACAGCTGGCGTTTGG - Intergenic
1025095401 7:56092164-56092186 CCCCAGTCAGAGCTGGGGCTGGG - Intronic
1026945516 7:74313595-74313617 CTTCAGGCTCAGCTGGATCTAGG + Intronic
1030360420 7:108589764-108589786 TTTCAGGCACAGCTGGACCTAGG - Intergenic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1032268499 7:130384353-130384375 CTGCAGGCACAGCTTGGGATGGG - Intronic
1032521990 7:132552489-132552511 CTACAGGCAGCCCTGGGGGTGGG + Intronic
1032980295 7:137274206-137274228 CTCTAGGCACAGCTGGGGTAAGG - Intronic
1033299202 7:140171728-140171750 GTACAGGCATAAGTGGGGCTAGG - Intronic
1034259931 7:149748687-149748709 CAACTGGCCCAGCTTGGGCTGGG + Intergenic
1034788151 7:153944162-153944184 CTTCCAGCACAGCCGGGGCTCGG + Intronic
1035303964 7:157917854-157917876 CAGCAGGCCGAGCTGGGGCTGGG + Intronic
1036560104 8:9894423-9894445 CTCCAGGCAAAGCTGGAACTTGG - Intergenic
1036763924 8:11534083-11534105 ATACCAGCACTGCTGGGGCTGGG + Intronic
1037773195 8:21815097-21815119 ATCCAGGCCCTGCTGGGGCTGGG + Intergenic
1037986906 8:23295828-23295850 CCACGGGCACAGCTGGGCCGAGG + Intronic
1038029049 8:23621093-23621115 CCATAGGCACAGCTGGGGAGAGG - Intergenic
1039491367 8:37950023-37950045 ATAAAGGCACACCTGAGGCTGGG - Intergenic
1040871184 8:52101208-52101230 CTCCAGGCAGAGATGGGGCTGGG + Intergenic
1044868660 8:96597119-96597141 TTTCAGGAACAGATGGGGCTGGG + Intronic
1044871865 8:96627654-96627676 CTTCAGGCACAGCTGGATCTTGG + Intergenic
1045507822 8:102791060-102791082 CTAGAGGAGCAGCTGGGCCTGGG - Intergenic
1045571509 8:103372402-103372424 GGACAACCACAGCTGGGGCTAGG + Intronic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1046974430 8:120258165-120258187 CTTCAGGCACATCTGGACCTAGG + Intronic
1047360078 8:124161015-124161037 CATCAGGCAAAGCTGGGGATGGG + Intergenic
1047796618 8:128263411-128263433 CTACTTGCACAGCTGGGTCTAGG + Intergenic
1048066848 8:130978967-130978989 CTTCAGGCACAGCTTGGTCCAGG - Intronic
1048071773 8:131028873-131028895 ATACAGGTACAGCTGGGGGCAGG - Intronic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049404320 8:142444941-142444963 CTTCAGGCTGAGCTGGGGGTGGG + Intergenic
1049500856 8:142964582-142964604 AGACAGGCACACCTGGGGGTGGG + Intergenic
1050030000 9:1375889-1375911 CTACAGGCAGAGCAGTGGCATGG + Intergenic
1053455208 9:38228269-38228291 TTAAACGCACAGCTGAGGCTGGG - Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1057503549 9:95614959-95614981 CCACAGGCCGAGCAGGGGCTGGG - Intergenic
1057511651 9:95684847-95684869 CTGCTGGCAAATCTGGGGCTGGG - Intergenic
1057522353 9:95770087-95770109 CTTCAGGCACAGCTGGATCTAGG - Intergenic
1057891526 9:98873651-98873673 CTTCAGGCACAGCTGGATCCAGG + Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059441143 9:114307555-114307577 CTTCATGCTCACCTGGGGCTCGG + Intronic
1059817898 9:117938502-117938524 CTAGAGGCACACCTGAGGCCTGG - Intergenic
1060487069 9:124054510-124054532 CCTGAGGCACAGCTGGGGCAAGG - Intergenic
1060740226 9:126092940-126092962 CTACAGGCACGGCTGTATCTAGG + Intergenic
1060822951 9:126671982-126672004 TCACGGCCACAGCTGGGGCTCGG - Intronic
1060898706 9:127238446-127238468 CTCAAGGCACACCTAGGGCTTGG + Intronic
1061250175 9:129421839-129421861 CTACAGGCGCTGCTGGGGTCAGG + Intergenic
1061446067 9:130638838-130638860 CCACAGCCACAGGTGAGGCTGGG - Intergenic
1061590606 9:131595185-131595207 GTCATGGCACAGCTGGGGCTAGG + Intronic
1061744936 9:132732733-132732755 CTACAGGCACAGCTTGAACCAGG - Intronic
1062436789 9:136549963-136549985 CTGCAGGCACCCCTGGGCCTGGG - Intergenic
1062536546 9:137023617-137023639 CTAAAGGCACAGCTGGTGCCTGG - Intronic
1186450848 X:9672545-9672567 CTACAGGCACAGATGTGGGAGGG - Intronic
1186824760 X:13328557-13328579 CTACGGTCACTGCTGTGGCTGGG - Intergenic
1186858919 X:13652286-13652308 CGGCAGTCACAGCTGGGCCTTGG + Intergenic
1188237202 X:27744956-27744978 CTAAAGGAATAGCTGAGGCTGGG - Intronic
1188809702 X:34638189-34638211 CTACTGGCAGACCTGGGCCTGGG - Intronic
1189568879 X:42274022-42274044 CCACAGGCAGATCTGGAGCTGGG - Intergenic
1189755743 X:44269751-44269773 CTAAAGGAATACCTGGGGCTGGG - Intronic
1190061691 X:47215702-47215724 ATACAGGCAGACCTGGGGCTGGG - Intergenic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1190928403 X:54928665-54928687 CCACAGCCACAGCTGCAGCTTGG - Exonic
1192811070 X:74547833-74547855 CTACAGCTACAGCTAGGGTTAGG - Intergenic
1198392246 X:136188291-136188313 CTACTGGCACAGCCTGGGCAAGG - Intronic
1200124303 X:153806020-153806042 CGACGGGCACAGCGGGGCCTTGG + Intronic
1201255785 Y:12107062-12107084 CTATAGGCACAGCAGCAGCTTGG + Intergenic