ID: 1068878040

View in Genome Browser
Species Human (GRCh38)
Location 10:62018538-62018560
Sequence ATATTGCCCGGTCTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068878036_1068878040 7 Left 1068878036 10:62018508-62018530 CCAAAGACTGGGTGGGTGCCAGA 0: 1
1: 0
2: 2
3: 16
4: 228
Right 1068878040 10:62018538-62018560 ATATTGCCCGGTCTCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068878040 Original CRISPR ATATTGCCCGGTCTCCATGT TGG Intronic
No off target data available for this crispr