ID: 1068878214

View in Genome Browser
Species Human (GRCh38)
Location 10:62020362-62020384
Sequence TTTTAAACACAGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068878214_1068878222 21 Left 1068878214 10:62020362-62020384 CCCTCCCCCATCTGTGTTTAAAA 0: 1
1: 0
2: 3
3: 32
4: 380
Right 1068878222 10:62020406-62020428 AGTCTGTTTGATCAATAGTCGGG No data
1068878214_1068878221 20 Left 1068878214 10:62020362-62020384 CCCTCCCCCATCTGTGTTTAAAA 0: 1
1: 0
2: 3
3: 32
4: 380
Right 1068878221 10:62020405-62020427 GAGTCTGTTTGATCAATAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068878214 Original CRISPR TTTTAAACACAGATGGGGGA GGG (reversed) Intronic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
901837130 1:11931485-11931507 TTTTTAATAGAGATGGGGGAAGG + Intergenic
901865642 1:12105052-12105074 TTTTAACCAGAGAAGGGGTATGG + Intronic
902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG + Intergenic
903408970 1:23123946-23123968 TTTTAAAGAGAGATGGTGAAAGG - Intronic
903516771 1:23916475-23916497 GTTAAAACACAGATTGGGGCCGG + Intergenic
903907841 1:26697975-26697997 TTGAAAGCACAGATGGGGGGCGG - Intronic
904025250 1:27498806-27498828 TTTTAAATAGAGATGGGGGTGGG + Intergenic
904678204 1:32211551-32211573 TGTGAAACACAGATTGGGGGAGG + Intronic
905779396 1:40694429-40694451 TTGTAAACAAAAATGAGGGAGGG - Intronic
905920668 1:41716618-41716640 CTTCAAACAAAGCTGGGGGATGG + Intronic
906053646 1:42896473-42896495 TTTTAATCACAAATGGATGATGG + Intergenic
906264916 1:44421469-44421491 TGACACACACAGATGGGGGAAGG - Intronic
907406296 1:54255457-54255479 TTAAAAACACAGATGGGGGCAGG + Intronic
908114603 1:60928415-60928437 TTTTAAATAGAGATGGGGTCCGG - Intronic
910079332 1:83322544-83322566 GTTTAAACACGTATGGGGGTAGG - Intergenic
910399670 1:86826133-86826155 TTTTAAATTGAGATGGGGGTTGG + Intergenic
914422994 1:147546375-147546397 TTTTAAAAAAAGGGGGGGGATGG - Intronic
914779806 1:150774921-150774943 TTTTAAGTAGAGATGGGGGGGGG + Intergenic
915301916 1:154956571-154956593 TTTAAAAAACGGTTGGGGGACGG + Intergenic
915827849 1:159097649-159097671 ATTTAAACATAGAAGGGGAAGGG - Intronic
916661257 1:166924042-166924064 TTTTGCACAAAGATGAGGGAGGG + Intronic
917589117 1:176459143-176459165 TTTTAAGCATAGGTAGGGGATGG - Intergenic
918120518 1:181535292-181535314 TTTTAAAGACAAATGGGGGAGGG - Intronic
918750998 1:188269233-188269255 TCTTATACACAGATGTGAGATGG - Intergenic
919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG + Intronic
920015242 1:202902133-202902155 TATAAAACACAAATGGGGGCCGG + Intronic
920103126 1:203530557-203530579 TTTAAAACACAGATTGGGGTAGG - Intergenic
920661761 1:207921443-207921465 TGTTACCCACAGTTGGGGGAGGG + Intergenic
920924938 1:210331962-210331984 TTTTATACACAGAAGTGGGATGG - Intronic
921122079 1:212145967-212145989 TTTAAAAAACAGATGGGGCCTGG - Intergenic
921458032 1:215395284-215395306 TTTTTAGTAGAGATGGGGGACGG + Intergenic
921833373 1:219752766-219752788 ATTTAACCAAAGATAGGGGAGGG - Intronic
922151440 1:223008191-223008213 AATTAATCAGAGATGGGGGATGG - Intergenic
923035440 1:230281832-230281854 TTTTAAAAACAGGAGTGGGAGGG - Exonic
1063119281 10:3093247-3093269 CTTTCAACACTGTTGGGGGAAGG - Intronic
1063273120 10:4534435-4534457 TTTTAAAAATAGAAGGGGGCTGG + Intergenic
1063481804 10:6382937-6382959 ATATAAACACAGGTGTGGGAGGG + Intergenic
1064538124 10:16378901-16378923 TTTTAAATATAGATGGGGTGGGG - Intergenic
1064666311 10:17655766-17655788 TTTTAAACACAGATGGGTTGGGG - Intronic
1068260413 10:54573746-54573768 ATTTAAACACAGAGAGGGTAGGG - Intronic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1069803547 10:71100747-71100769 TTTTAAAAATAGAGGTGGGAAGG - Intergenic
1070350892 10:75591352-75591374 AGTTAAAAACAGATGGGGCAAGG + Intronic
1071885432 10:89944564-89944586 TGTTAAAAAAAGATTGGGGATGG + Intergenic
1075565313 10:123499256-123499278 TTTTAGGAATAGATGGGGGAGGG + Intergenic
1077580148 11:3412258-3412280 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1078440181 11:11358417-11358439 TTTCAAACTCAGATGATGGAAGG - Intronic
1079119792 11:17673682-17673704 TTTGAAAGACAGATTGGGGAAGG - Intergenic
1079520864 11:21324970-21324992 TATAAAACAAAGATGGGGGGAGG - Intronic
1080604888 11:33857144-33857166 ATTAAAACACAGGTGGGGCACGG + Intergenic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1081483312 11:43508277-43508299 CTTTAAACACAGGAAGGGGAGGG + Intergenic
1081848634 11:46259694-46259716 TTTTTAGTAGAGATGGGGGAGGG - Intergenic
1082644692 11:55707878-55707900 ATTTAAATACAGATGGGTGACGG - Intergenic
1083571916 11:63765647-63765669 TATTATACAAAGGTGGGGGAAGG - Intronic
1084237072 11:67795085-67795107 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1084835331 11:71797749-71797771 TTTTAAACAAAAATGGGGCTGGG - Intronic
1085054616 11:73396261-73396283 CATTAAAAACAGCTGGGGGAGGG - Exonic
1085197507 11:74681485-74681507 TTATAGACCCAGATGGGGGTGGG - Intergenic
1085617644 11:78013590-78013612 TAATAAACTCAGATGGGGAAGGG - Intergenic
1086162433 11:83737571-83737593 TTATAAACACAGATTGGAAAAGG + Intronic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1087419783 11:97907398-97907420 CTTTAAACACAGATGTCAGAAGG + Intergenic
1087617087 11:100499292-100499314 TTATCAACTCAGATGGGGGAAGG + Intergenic
1088083225 11:105945555-105945577 ATTAAAAAACAGGTGGGGGAGGG - Intronic
1088509765 11:110562371-110562393 TTTAAAATACAGAGGGGGAATGG - Intergenic
1089087635 11:115836750-115836772 TTTTAAACACAGAAGCCAGAAGG - Intergenic
1089916277 11:122159966-122159988 TTTTAACCAAAGATGTGGGAGGG - Intergenic
1093247595 12:16759564-16759586 TTTTCAACAAAGATTGGTGAAGG - Intergenic
1093414174 12:18901319-18901341 TGTTAAAAACAGTTGGGGCAAGG + Intergenic
1093421487 12:18979353-18979375 TCTTAAACAGAGATGGGGAAGGG - Intergenic
1094359197 12:29611787-29611809 TGTTTCACACAGATGGGGCAGGG + Intronic
1094480203 12:30875424-30875446 ATTTAAAAACAGATGGGGAAAGG - Intergenic
1095887480 12:47204243-47204265 TTTTAAATTCATATGGGGGTTGG - Intronic
1096914765 12:55019792-55019814 GTTTAAATAGAGATGGGGGTTGG - Intergenic
1097240430 12:57571461-57571483 TTTTAAAATCAGATGGAAGAAGG + Intronic
1097655900 12:62363185-62363207 TTTTAAGAACAGATTGTGGAGGG - Intronic
1098685819 12:73419148-73419170 TTTTATAAAGAGATGGGGGTAGG - Intergenic
1100088333 12:90938428-90938450 TTTTCAACATAGCTGGAGGATGG + Intronic
1100554168 12:95675826-95675848 TTTTAAAGACAGATTGGGTAAGG + Intronic
1100986261 12:100204133-100204155 CTTTAAAAAAAAATGGGGGAGGG + Intronic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1102156366 12:110732458-110732480 TGGAAAACACTGATGGGGGAGGG - Intronic
1102298574 12:111755578-111755600 TTTTTAGTAGAGATGGGGGACGG + Intronic
1103534309 12:121624380-121624402 TTTAAAATAAAGATGGGGGCCGG - Intergenic
1104029293 12:125053021-125053043 TTTTTAATAGAGATGGGGGCTGG - Intergenic
1106219936 13:27737577-27737599 TTTTAATGACAGATTGGGCAGGG + Intergenic
1107223705 13:38019774-38019796 TTTTGAAAACATATGGAGGATGG - Intergenic
1109111367 13:58323584-58323606 TTTTAAACACAGAAAGTGTAGGG + Intergenic
1110085970 13:71380165-71380187 TTTTTAACACATAGGAGGGAAGG + Intergenic
1110128358 13:71976702-71976724 TTTTCAATACATAGGGGGGAAGG + Intergenic
1110498485 13:76197726-76197748 TTTAAAACAAAAATGGGTGAAGG - Intergenic
1111562288 13:89967047-89967069 TGTGAGACAGAGATGGGGGAAGG + Intergenic
1111876499 13:93903783-93903805 TTTTAAAAACAGTTGGGGCGGGG - Intronic
1115456131 14:33605270-33605292 TTTAAAATACTGATGGCGGAAGG - Intronic
1115933025 14:38519343-38519365 TTTTAAAGACTAATGTGGGAAGG - Intergenic
1116788828 14:49317954-49317976 TTTAAAATACACATTGGGGATGG + Intergenic
1118090346 14:62468853-62468875 TTTTAAATACATATGTAGGAGGG + Intergenic
1118266559 14:64300389-64300411 TTTTAGACTGAGATGAGGGAGGG - Intronic
1119254868 14:73186478-73186500 TTTTAAAGAGAGATGTGGGCCGG + Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1119872565 14:78029819-78029841 TTTTTAAGAGAGAAGGGGGATGG - Intergenic
1119890733 14:78180153-78180175 TTTAAAATAAACATGGGGGAGGG + Intergenic
1120691806 14:87601227-87601249 TTTTTAACAGAGATGGGGTGGGG - Intergenic
1121017258 14:90556306-90556328 TTTAAACGGCAGATGGGGGAGGG - Intronic
1121060842 14:90908267-90908289 TTTTAAATTCAGATGAGGCAGGG + Intronic
1121977357 14:98417579-98417601 TTCTAAACACAGGTATGGGAGGG - Intergenic
1123834281 15:24172173-24172195 TTTTAAAGACACAGAGGGGAGGG - Intergenic
1124648494 15:31457521-31457543 TTTTAAACACATATAGTAGAAGG - Intergenic
1124820280 15:33038315-33038337 TTTTAAACACAGAAGATGCAGGG - Intronic
1125097352 15:35870256-35870278 GTCAAAGCACAGATGGGGGAGGG - Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1127282635 15:57504924-57504946 TTTTTAAAACAGATGAGGGCTGG + Intronic
1127512123 15:59653199-59653221 ATTTAGAAACAGATGAGGGATGG + Intronic
1127582943 15:60354344-60354366 TTTGAAACATAGATGGGGCCGGG + Intronic
1128383880 15:67133419-67133441 TTTTAAATGCATTTGGGGGATGG + Intronic
1129023367 15:72545146-72545168 TTTAAAAAACAAATGGGGGTTGG - Intronic
1130180393 15:81621225-81621247 TTTTAAGTACAGATGGGGTTTGG + Intergenic
1130304686 15:82705239-82705261 TTTTAAAGCCTGCTGGGGGATGG - Intronic
1131647309 15:94359442-94359464 ATTTAAACACAGATGTTGAAAGG + Intronic
1131675385 15:94665868-94665890 TTTTCAACACAGGTCAGGGAGGG - Intergenic
1132593772 16:738823-738845 TTTTTAGTACAGATGGGGGTTGG + Intronic
1133049472 16:3108905-3108927 TTTTAAATAGAGTTGGGGGCCGG + Intergenic
1133348678 16:5087501-5087523 TTTTAAACAAAAATGGGGTTGGG + Intronic
1133897481 16:9943319-9943341 TTTTAAACACAGAGCGAGGGAGG + Intronic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1136009199 16:27351808-27351830 TTTTAAAGAGAGATGGGGCTGGG - Intronic
1136108451 16:28048915-28048937 TTTTTAAAAAAGATGGAGGAGGG + Intronic
1138176338 16:54901489-54901511 TGTTAAGAACAGATGGGGGCTGG - Intergenic
1139256254 16:65545743-65545765 TTAGCAGCACAGATGGGGGATGG - Intergenic
1139482783 16:67239904-67239926 TAATAAACACAGATGAGGAAGGG + Intronic
1139642848 16:68305316-68305338 TTTTAACCACAAATTGGGAATGG + Intronic
1140703580 16:77605259-77605281 TTTGAAACAAAGATTAGGGAGGG + Intergenic
1141761420 16:86031146-86031168 TTTTAGACATAGGTTGGGGAGGG - Intergenic
1142493133 17:291370-291392 TTTTAAAATGAGATGGGGGGTGG - Intronic
1142593746 17:1019620-1019642 ATTTAAACACAGAGGAGGGAGGG + Intronic
1142835001 17:2578885-2578907 TTTTTAATAGAGATGGGGGGAGG - Intergenic
1143296028 17:5872805-5872827 TTTTCCACACATATGGTGGAAGG - Intronic
1144353290 17:14420153-14420175 AGTTAAACCCAGAGGGGGGAAGG - Intergenic
1144611051 17:16716061-16716083 TTTTAAACATAGTTGATGGAAGG - Intronic
1144901684 17:18599302-18599324 TTTTAAACATAGTTGATGGAAGG + Intergenic
1144929388 17:18846758-18846780 TTTTAAACATAGTTGATGGAAGG - Intronic
1145130819 17:20346765-20346787 TTTTAAACATAGTTGATGGAAGG - Intergenic
1146362265 17:32186659-32186681 TTTAAAACAAAAATGGGGGCCGG - Intronic
1146555360 17:33818508-33818530 TCTCAACCTCAGATGGGGGAAGG + Intronic
1147328797 17:39684285-39684307 TTACAAACACAGAGGGGAGATGG - Intronic
1147642555 17:42012976-42012998 TTTTTTACAGAGATGGGGGGCGG + Intronic
1148002355 17:44397330-44397352 TTAGAAACACAGAAGAGGGAGGG + Intronic
1148068742 17:44893754-44893776 TTTTAAAAAAAGGTGGGGGGGGG + Intronic
1148148845 17:45384255-45384277 TGGGAAAGACAGATGGGGGAAGG + Intergenic
1148523386 17:48304248-48304270 TTTTAAATACAGATAAGGAAAGG + Intronic
1151132583 17:71912929-71912951 TTTTATTCACAGCTGGTGGATGG - Intergenic
1151327798 17:73389675-73389697 TTGTCAACACAGATGGGCGCAGG - Intronic
1152149953 17:78592780-78592802 TTAAAAATACAGATGGGGGCAGG + Intergenic
1152393757 17:80019038-80019060 TTTGAAACACAGAAGGAGGTGGG - Intronic
1153677095 18:7465495-7465517 TTTTCTCCACAGATGGGGGGAGG + Intergenic
1153902644 18:9631724-9631746 TTTTAAAAACAGTTTGGGCATGG - Intergenic
1153915038 18:9737865-9737887 TTTTAAAAGCAGAAGGGGGTGGG - Intronic
1155955178 18:31950884-31950906 TTTTAAATAGAGATGGGGTCTGG - Intronic
1155975958 18:32132163-32132185 TTTTGAAAAAAGATGGGGAAGGG + Intronic
1155991243 18:32281676-32281698 TCTTAAAGACAGATGGAGGCCGG + Intronic
1156826379 18:41434619-41434641 TTTTAAATACAAAAGGGTGAGGG + Intergenic
1157168254 18:45378412-45378434 TTTTCAATAGAGATAGGGGATGG - Intronic
1157466357 18:47949659-47949681 TTTTAAAGGCAAATGGGGGAGGG + Intergenic
1158278773 18:55797821-55797843 TTTAAAAAACAGATGGAGCAAGG - Intergenic
1158482475 18:57834322-57834344 TATTAAAAAGAGATGGGGGCTGG + Intergenic
1158549266 18:58421045-58421067 TCTTAAACAGAGATGGGGTGAGG - Intergenic
1158915324 18:62120190-62120212 TCTTAAAAGCAGCTGGGGGAAGG + Intronic
1159013789 18:63084555-63084577 TTTAAAACACAAATGCAGGATGG + Intergenic
1159304499 18:66622580-66622602 TTTTTTACATAGATGTGGGAAGG - Intergenic
1159342405 18:67152917-67152939 TTATAACCAAAGATGGGAGAAGG + Intergenic
1161005187 19:1932116-1932138 TTTGAAACACAGAAGGGGCAAGG + Intergenic
1161241650 19:3226410-3226432 TTTTGAAAAGAGATGGGGAATGG - Intronic
1161437199 19:4270692-4270714 TTTTAAAGAAAGGTGGGGCACGG + Intergenic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1162295172 19:9808462-9808484 TTTTAAATAGAGATGGGGCCAGG - Intergenic
1162447993 19:10735971-10735993 TTTTAGATAGAGATGGGGGCTGG + Intronic
1162706405 19:12558310-12558332 TTTTAAAAACTGATGGGGCTGGG + Intronic
1162960829 19:14125458-14125480 TTTGACACAGAGGTGGGGGAAGG + Intronic
1163083721 19:14963736-14963758 TTTTGACCACAGATGGTTGAGGG - Intronic
1166621991 19:44309398-44309420 TTTAAAACAAAGATGGGGCCGGG - Intergenic
1166767616 19:45261606-45261628 TTTAAAACAGAGATGGGGCCAGG - Intronic
1167030316 19:46954604-46954626 TTTCAAACAAAGATGGTGCAAGG + Intronic
1167303318 19:48692479-48692501 TTTTAAACACAAGTGTGTGAGGG - Intergenic
1167662188 19:50802173-50802195 TTTTAAACCCAGGTGAGTGAAGG + Intronic
1167988023 19:53334728-53334750 TTTTTGACAGAGATGGGGGGGGG - Intronic
925015282 2:519513-519535 TTTTAAACACAGAATGGAGAAGG - Intergenic
926273737 2:11387765-11387787 TTTTAAACAAAGATGCTGGTTGG - Intergenic
926505760 2:13713615-13713637 TTTTAAAAATATATGGGTGAGGG - Intergenic
926795293 2:16614222-16614244 TTTTATGGACAGATGGGAGATGG + Intronic
928242031 2:29594881-29594903 TTCTAAACAAAAATGGGGGGTGG + Intronic
928840645 2:35600324-35600346 TTGTAAATAAAGATGGGGGAGGG + Intergenic
929449623 2:42028040-42028062 ATGTAAACCCAGATGGGGGTGGG + Intergenic
930280779 2:49367416-49367438 TTTTAATCACACATGGGAGTGGG - Intergenic
931310990 2:61080413-61080435 TCTTAAACACAAATGGTGAAGGG - Intronic
931806782 2:65814857-65814879 TTTAAAAAAAAGATGGGGGATGG - Intergenic
932102616 2:68914467-68914489 TTATACACACAGATGCTGGAAGG + Intergenic
932843882 2:75114918-75114940 TTGTAAACACAGACAGGGAATGG + Intronic
933314973 2:80704793-80704815 TATTTAACACACTTGGGGGAAGG - Intergenic
933866587 2:86523701-86523723 TTTTAAAGAAAGAGGTGGGAGGG - Intronic
934841361 2:97626260-97626282 TCTGGAACTCAGATGGGGGATGG - Intergenic
934908693 2:98229909-98229931 ATATTAACCCAGATGGGGGAAGG + Intronic
934964709 2:98710635-98710657 TTTTTAGTACAGATGGGGGGCGG + Intronic
935035827 2:99372208-99372230 TTAAAAACAAAGATGGGGGGAGG - Intronic
936541598 2:113356119-113356141 GTTTAAACACAGATGGCCCAAGG - Intergenic
936868604 2:117107302-117107324 TTATAAGCACAGAATGGGGATGG - Intergenic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
939632991 2:144547764-144547786 TTTTAAAGTCAGATTGGGTAGGG - Intergenic
940425193 2:153524000-153524022 TTTTAATCACAAATGGGTGTTGG + Intergenic
940583656 2:155614885-155614907 TTTTAAACACCGATAGATGAAGG + Intergenic
941046387 2:160680431-160680453 TTTTAAACATAGATCAGTGAAGG + Intergenic
941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG + Intronic
942306482 2:174612185-174612207 TTTTAAAAATAGGTGGGGTATGG - Intronic
942879948 2:180847321-180847343 TGTTAAACATAGATGGGGAGGGG + Intergenic
943577360 2:189646120-189646142 TTTTAAACACTCAGGTGGGAGGG + Intergenic
943734198 2:191336043-191336065 TTTCAAGCACTGATGGGGGCAGG + Intronic
943757952 2:191577092-191577114 TTTAAAATACAGAAGGGAGATGG - Intergenic
943839759 2:192564231-192564253 TATTAAATATAGAGGGGGGAGGG - Intergenic
943863807 2:192902054-192902076 ATTTAAACAAAAAAGGGGGAGGG - Intergenic
943984866 2:194605817-194605839 CTTTAAAAAAAAATGGGGGAAGG + Intergenic
944023943 2:195141540-195141562 TTTCAAAAACACATGGGGGGTGG + Intergenic
944150962 2:196558238-196558260 TTTCAAACTCAGATGGGCTATGG + Intronic
944227588 2:197363711-197363733 TTTTTATTAGAGATGGGGGAAGG - Intergenic
944478048 2:200126985-200127007 TTTTCAACAGAGATGGCAGATGG + Intergenic
945898883 2:215516223-215516245 TCTTAAAGACATATGGTGGAAGG - Intergenic
946883474 2:224199465-224199487 TGCTCAACACAGATGGGGGCAGG + Intergenic
946966139 2:225040419-225040441 CTTTAAAAAGAGGTGGGGGAGGG - Intronic
947111721 2:226725854-226725876 TTTTTTTCACATATGGGGGATGG + Intergenic
948351278 2:237343137-237343159 TGTTCAAGACAGATGGGTGATGG - Intronic
1169507470 20:6227513-6227535 TTTTAAAAATAAATGGTGGAGGG + Intergenic
1170501231 20:16976562-16976584 TCCTAAACACATGTGGGGGATGG + Intergenic
1170558430 20:17534614-17534636 TAATAAAAACAGAAGGGGGATGG + Intronic
1170954014 20:20962041-20962063 TTTTAAATAGAGATGGGGTCTGG - Intergenic
1171027295 20:21642424-21642446 TTTAAAATACAGGTGGGGGATGG - Intergenic
1171037306 20:21725836-21725858 TTTTAAACTCTGTTGGGTGAGGG + Intergenic
1171149310 20:22812975-22812997 TTTTAAACACAGAAAGCGAATGG + Intergenic
1172707038 20:36889463-36889485 TTTGAAACACAGATGGTGAAGGG + Intronic
1173869958 20:46335136-46335158 ATTAAAACACAGAGGAGGGAAGG - Intergenic
1173996943 20:47345819-47345841 TTTTTAATAGAGATGGGGGCGGG + Intronic
1174205088 20:48832363-48832385 TTTTAAACAGAGCTTGGGAAGGG - Intergenic
1177502575 21:21977161-21977183 TTTTAAACAGAGATGAGTTAGGG + Intergenic
1179343447 21:40533802-40533824 TTTCAAACCTAGATGGAGGAAGG - Intronic
1179526272 21:41977897-41977919 TTCCAAACAGAGATGGGTGAGGG + Intergenic
1181931251 22:26403408-26403430 TTTTTAACACAGTGGAGGGATGG - Intergenic
1182244597 22:28945821-28945843 TTTTAAATAGAGATGGGGCCGGG - Intronic
1182881167 22:33734762-33734784 GTTTAAACAGAGGTGGGAGAAGG - Intronic
1183189051 22:36309951-36309973 TTTTAAATAGAGATAGGGGCTGG + Intronic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
949101109 3:146255-146277 TTTTAAAAAAGGGTGGGGGACGG + Intergenic
950298895 3:11856881-11856903 TTTTTAGTAGAGATGGGGGATGG + Intergenic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950780421 3:15386967-15386989 TTTTTAGCAGAGATGGGGGGTGG + Intronic
950947011 3:16959726-16959748 TTCTAAACACAGATGGGATATGG - Intronic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952691059 3:36206719-36206741 TCTTAAACACAGAATGGGGTAGG + Intergenic
952798719 3:37268016-37268038 TTTTAAAAACTGATTTGGGAGGG + Intronic
954972560 3:54663510-54663532 TTTAAAACACAAATGGGGTCTGG + Intronic
955375441 3:58392075-58392097 TTTTAAACAAAGATGAGAGTAGG + Intronic
955434394 3:58886542-58886564 TTTTAAAGATATATGGGGTATGG - Intronic
955962933 3:64359386-64359408 TTTTAAAAAAAGGTGGGGGTGGG + Intronic
956662149 3:71609876-71609898 TTTTTAATAGAGATGGGGGGGGG - Intergenic
958878074 3:99638300-99638322 TCTTGACCACAGATGGGGAAAGG - Intergenic
959204776 3:103292458-103292480 ATTCAGAGACAGATGGGGGAAGG + Intergenic
959730300 3:109593440-109593462 TTTTAAATCTAGATGGGGAAGGG - Intergenic
960146442 3:114209063-114209085 TTTTGAACTCAGATCAGGGATGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961301813 3:125926685-125926707 TTTTAAACAAAAATGGGGCTGGG - Intergenic
961690169 3:128663743-128663765 TTTTCAACAATGATGGGGGCAGG - Intronic
961799384 3:129433565-129433587 TTTTAAACACACATGAAAGAGGG + Intronic
961886654 3:130101153-130101175 TTTTAAACAAAAATGGGGCTGGG + Intronic
964603144 3:158526193-158526215 CTTTAAACAGAGGTGGGGTAGGG - Intronic
965327323 3:167323314-167323336 CTCTAAACACAGAAGGGTGATGG + Intronic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
966221424 3:177555292-177555314 TGAAAAACACAGATGGGGGCTGG + Intergenic
966615079 3:181904538-181904560 TTTAAAATAGAGATGGGGGCCGG + Intergenic
967729895 3:192897627-192897649 GATCAAACACATATGGGGGAGGG + Intronic
968995821 4:3945170-3945192 TTTTAAACAAAAATGGGGCTGGG + Intergenic
969606695 4:8205513-8205535 TGTTAAACACACGCGGGGGAAGG - Intronic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
971316323 4:25571255-25571277 TTTTAAATAGAGATGGGGCCAGG + Intergenic
973333411 4:48932340-48932362 GTATAAACACAGATTGGGCATGG + Intergenic
974358317 4:60841521-60841543 TTTTAAAAAGAGATTGAGGAAGG + Intergenic
974819981 4:67054019-67054041 TTCTAAACTCTGGTGGGGGATGG + Intergenic
975611236 4:76205776-76205798 TGTTTAACAGAAATGGGGGAGGG - Intronic
976224777 4:82787343-82787365 TTTTAAACACCCTTGTGGGAGGG - Intronic
976513371 4:85935862-85935884 TTTCAAAGTCAGAGGGGGGAAGG - Intronic
978221826 4:106286529-106286551 TTTTAAAAAAGGTTGGGGGATGG + Intronic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
979829176 4:125279497-125279519 TCTTATACACAGAAGGGAGATGG + Intergenic
980424763 4:132613670-132613692 TTAGAAACACAGAGGGGGAAAGG + Intergenic
982174763 4:152695150-152695172 TTCTAAACACTGATGGGGCTGGG + Intronic
982306171 4:153933557-153933579 TCTTATACAAAGATGGGCGAGGG + Intergenic
984255062 4:177381359-177381381 TTATACTCATAGATGGGGGAGGG + Intergenic
985615573 5:918511-918533 TTTTTAAAACAGTTGGGGGTGGG + Intronic
986065493 5:4230218-4230240 TTTAAAAGACAGATGGCAGAAGG - Intergenic
987288386 5:16483744-16483766 TTTAAAACTCAGATATGGGATGG + Intronic
987352690 5:17035357-17035379 TTTTAAACTCAAAGGGGAGAGGG - Intergenic
987667808 5:20967226-20967248 TTTTAAACACACAGGGAAGAAGG - Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
989148441 5:38272362-38272384 TTTTAAAGACAAATGGGGGAAGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
990588437 5:57236595-57236617 TTTTAAAAAAAAATGGGGGCTGG - Intronic
992833366 5:80616915-80616937 TTTTATACAGAAATGGGGGAAGG + Intergenic
993526286 5:88969821-88969843 TTTTAGACACAGATGATGGTGGG - Intergenic
994560778 5:101368361-101368383 GTTTTCAGACAGATGGGGGAGGG - Intergenic
995551488 5:113286158-113286180 TTCTGAACACAGATAAGGGAAGG + Intronic
997396878 5:133568049-133568071 TTTCAGACAAAAATGGGGGAGGG + Intronic
998007618 5:138667308-138667330 TTTTAAATAGAGATGGGGCTGGG + Intronic
999962910 5:156776182-156776204 ATTTAAACACTGAGTGGGGATGG - Intergenic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000949203 5:167460097-167460119 TTCTAAACTCAGATGTGAGAGGG - Intronic
1003306490 6:4933615-4933637 TTTTAAACAAAGATGGGAGAAGG + Intronic
1003328873 6:5113041-5113063 TTTTAACCACAGATCTGGGTGGG - Intronic
1003981730 6:11396305-11396327 ATTGAAACACAGTTTGGGGAAGG - Intergenic
1004340316 6:14802710-14802732 TTTCAGCCACAGATGAGGGAGGG + Intergenic
1004355834 6:14929259-14929281 TTTTGAACACTAATGGGGAAGGG + Intergenic
1005344094 6:24872388-24872410 TTAAAAACACAGACGGGGGGTGG + Intronic
1007603979 6:43103234-43103256 TTTTAAACTCAGAAGGGAGAAGG - Intronic
1008001135 6:46360948-46360970 TTTTACACATACATGGGGGTAGG - Intronic
1008111620 6:47501207-47501229 TTTTAAATAGAGATGGGGTCTGG - Intronic
1008360510 6:50612126-50612148 TTAGAAAAACAGATGGTGGAGGG + Intergenic
1009039964 6:58164393-58164415 TTGTAAACACTCATGGGGAATGG - Intergenic
1009215857 6:60919242-60919264 TTGTAAACACTCATGGGGAATGG - Intergenic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1011449823 6:87480875-87480897 TTTGTACCACAGAAGGGGGATGG - Intronic
1011458472 6:87578113-87578135 TTTTAAATAGAGATGGCGGGGGG - Intronic
1012420681 6:99061591-99061613 TTTAAAAACCAGATGGAGGAAGG - Intergenic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013268941 6:108527872-108527894 TTTAAAACACAGATGGGCTCTGG + Intergenic
1013438351 6:110136686-110136708 TTTAAAACAAAGATAGGAGAAGG - Intronic
1013680249 6:112517380-112517402 ATTTGAACATAAATGGGGGAAGG + Intergenic
1014136426 6:117895175-117895197 TTCTAAGCATAGCTGGGGGATGG + Intergenic
1014939800 6:127424668-127424690 TTTTAAACATAAAAGGGGGTTGG - Intergenic
1014988777 6:128048020-128048042 TTATAAACAGAGAGGTGGGAAGG - Intronic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016672545 6:146725941-146725963 TTTTTAACACAGATGAGATAAGG - Intronic
1016685419 6:146876541-146876563 TTTTCAACAGACATGAGGGATGG + Intergenic
1016692296 6:146951585-146951607 TTTTAAAAACGGATAGGGCAAGG + Intergenic
1017316823 6:153040760-153040782 TTTTAAAAACATATGGGTAAAGG + Intronic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1019862189 7:3669588-3669610 GTTTAAAGACAGGTGGAGGAAGG - Intronic
1021027007 7:15681659-15681681 TTTGAAACACAGAGGGAGAATGG + Intronic
1021927726 7:25549477-25549499 TTTTATCCTCAGGTGGGGGAGGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1025087482 7:56034907-56034929 TTTTAAATAGAGATGGGGGGGGG + Intronic
1025899466 7:65732139-65732161 TTTTAAATAGAGATTGGGGGGGG + Intergenic
1027182023 7:75947589-75947611 TTTAAAACACACATTGGGGCCGG - Intronic
1027297099 7:76787829-76787851 GTTTAAACACGTATGGGGGTAGG - Intergenic
1027407560 7:77877929-77877951 TTTGAATCACTGTTGGGGGAAGG + Intronic
1027743137 7:82037942-82037964 TTTAAAACACAGATGTGTGCAGG - Intronic
1028402890 7:90443417-90443439 TTTTAAACTCAGATGATGTAAGG + Intronic
1030051949 7:105545979-105546001 TTTTTAGTAGAGATGGGGGATGG + Intronic
1030361359 7:108598628-108598650 TTTGTAAAAAAGATGGGGGATGG + Intergenic
1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG + Intergenic
1031077677 7:117228443-117228465 TGTAAAACACAGATTGGAGAAGG + Intronic
1033117157 7:138635406-138635428 TTTTAAATAGAGATGGGGGTGGG + Intronic
1033754632 7:144388268-144388290 TTTAAAATAGAGATGGGGGTTGG + Intergenic
1034233246 7:149548873-149548895 TCATAAACACAGAAGGGGCAGGG - Intergenic
1035290111 7:157832418-157832440 TTTTAAACATACATTTGGGAAGG + Intronic
1035314350 7:157988864-157988886 CTTTAGACACAGATGTGAGAAGG - Intronic
1035575347 8:701100-701122 TTTTAAACACACATGGCCAAGGG + Intronic
1036575754 8:10026413-10026435 TTTGACACACAAATGGGAGATGG - Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036814983 8:11895414-11895436 TTTTAAATAGAGATGGAGGCAGG - Intergenic
1038594728 8:28877821-28877843 TTTTTAAAATAGTTGGGGGAGGG + Intronic
1039107838 8:34008569-34008591 TTTTTAAAACAGGTTGGGGAAGG + Intergenic
1039438986 8:37581595-37581617 TTTGAAACTCAAATGGGGCAAGG + Intergenic
1040045228 8:42956058-42956080 TTTTAAAGACAAAAGGGAGAGGG - Intronic
1040596517 8:48842810-48842832 TTTTAAAAAAAGTGGGGGGAGGG - Intergenic
1041108654 8:54466099-54466121 TTTTAAAAACAGATTGGGGTTGG + Intergenic
1041119425 8:54571199-54571221 GTTTACACAGAGATGGGGAATGG - Intergenic
1041206688 8:55506539-55506561 TCTTAAACAAAGATGGTGCAAGG - Intronic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1043436211 8:80238408-80238430 TTTCCAACGCAGCTGGGGGATGG - Intergenic
1043538672 8:81234442-81234464 TTTTAAATAAGGCTGGGGGATGG + Intergenic
1043620509 8:82186285-82186307 ATTTAAACACTGAGTGGGGAGGG + Intergenic
1043857672 8:85279956-85279978 TTTTAAGTACAGATATGGGAAGG - Intronic
1044885511 8:96772592-96772614 TTTAAAGGACAGATGGGGGAAGG + Intronic
1045528330 8:102960491-102960513 TTTGCAACAAAGATGGTGGATGG + Intronic
1046619560 8:116513867-116513889 TTTTAAAAACAGAAGTGGGTGGG - Intergenic
1047533736 8:125700261-125700283 TTCCAAACACAGATGGAGGAAGG + Intergenic
1047550791 8:125870364-125870386 GGTAAAACACAGATGTGGGAAGG - Intergenic
1047673773 8:127177415-127177437 TGTAAAACAAAGATGTGGGAGGG - Intergenic
1048533565 8:135272578-135272600 TTTTAAATTCAGATGTGGGTAGG - Intergenic
1050032965 9:1405642-1405664 TGTTTCACACAGATGGTGGAAGG - Intergenic
1051387263 9:16522547-16522569 TTTTTTACAGGGATGGGGGAGGG + Intronic
1052272303 9:26639615-26639637 TTTTAAACAGAGTTGCGGTAGGG - Intergenic
1052677248 9:31643089-31643111 TTTTAGAGACAGATAGGAGAGGG - Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1057403064 9:94741569-94741591 TTTAAAAAAAAGAAGGGGGAAGG - Intronic
1057989507 9:99753445-99753467 TTATAATCACAGATGTAGGATGG - Intergenic
1058398332 9:104582466-104582488 TTTTAAAAACACATGGAGAATGG + Intergenic
1058475648 9:105329812-105329834 TTTTCCAGACAGATGGGGAAGGG - Intronic
1059931942 9:119269519-119269541 TTTTAAACAGGGGTGGGGGTAGG - Intronic
1060674501 9:125500486-125500508 TTAAAAACACAAATGGGGGCCGG - Intronic
1060758402 9:126228766-126228788 TGATAAACACAGATGCGTGAGGG + Intergenic
1062240554 9:135535394-135535416 TTTTTAATAGAGATGGGGGGGGG + Intergenic
1062353304 9:136149582-136149604 TTTAAATCAAAGATGGAGGAGGG + Intergenic
1186014314 X:5173921-5173943 TATTTAACACAGAGGGAGGAAGG + Intergenic
1186090838 X:6047492-6047514 TTTTAAAAAGAGATGGATGATGG + Intronic
1187174706 X:16885782-16885804 TCTTAGACAAAGTTGGGGGATGG + Intergenic
1187358222 X:18598983-18599005 TGCCAAACACAGATGGTGGATGG + Intronic
1187649132 X:21380879-21380901 TTTTAAAAAAGGTTGGGGGAAGG + Intronic
1187733377 X:22279413-22279435 GTTTAAACACAAATGAGCGATGG - Intergenic
1187998722 X:24957777-24957799 TTTTAAGCAGAGAAGGGGCATGG + Intronic
1190818493 X:53950269-53950291 TTTTAAACACCCATCAGGGAGGG - Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1193046938 X:77063842-77063864 TTTTCCACACAGCTGGGAGAAGG - Intergenic
1194666198 X:96680280-96680302 TTTTAAAAACACATGGTGAAAGG - Intergenic
1195714501 X:107805532-107805554 TTTTAAAAAGAAATGGGGGTGGG - Intergenic
1196172195 X:112601813-112601835 TTTTAAACATAGTTGGATGATGG + Intergenic
1197359190 X:125477544-125477566 TTTTCAACACAGATGGGTTTCGG - Intergenic
1199724045 X:150564865-150564887 TTTTAAATACAGACTGGGGTTGG + Intergenic