ID: 1068880952

View in Genome Browser
Species Human (GRCh38)
Location 10:62048258-62048280
Sequence TGCCCAGCACAACACCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068880952_1068880956 14 Left 1068880952 10:62048258-62048280 CCTTTTGGGTGTTGTGCTGGGCA 0: 1
1: 0
2: 0
3: 10
4: 169
Right 1068880956 10:62048295-62048317 CCCACAGGGTCTTGCCCTTAAGG No data
1068880952_1068880953 -1 Left 1068880952 10:62048258-62048280 CCTTTTGGGTGTTGTGCTGGGCA 0: 1
1: 0
2: 0
3: 10
4: 169
Right 1068880953 10:62048280-62048302 AGATAAAAGACACATCCCACAGG No data
1068880952_1068880959 28 Left 1068880952 10:62048258-62048280 CCTTTTGGGTGTTGTGCTGGGCA 0: 1
1: 0
2: 0
3: 10
4: 169
Right 1068880959 10:62048309-62048331 CCCTTAAGGATTCTCCAGTCTGG No data
1068880952_1068880954 0 Left 1068880952 10:62048258-62048280 CCTTTTGGGTGTTGTGCTGGGCA 0: 1
1: 0
2: 0
3: 10
4: 169
Right 1068880954 10:62048281-62048303 GATAAAAGACACATCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068880952 Original CRISPR TGCCCAGCACAACACCCAAA AGG (reversed) Intronic
900140162 1:1136478-1136500 TGCCCTGCCCAGCACCCACAGGG - Intergenic
901237844 1:7677028-7677050 TCCCCAGCTCAACACCCACTGGG + Intronic
902618982 1:17639611-17639633 TGCCCTGCCCACCTCCCAAAGGG + Intronic
902619452 1:17642425-17642447 TGCCCAGAACAAATCCCATACGG - Intronic
905916132 1:41685568-41685590 TGCCCAGCTCAACTCCCCACGGG + Intronic
906076617 1:43056570-43056592 TGCCAACCACAACAGCCACATGG + Intergenic
906956949 1:50382048-50382070 TGCCGAGCACACCTCCCAGACGG - Intergenic
907259653 1:53207893-53207915 TGCACAGCAGAACCCCCAGAGGG - Intronic
907745234 1:57206685-57206707 TGGCCAGCAAAAGAACCAAAAGG - Intronic
909867413 1:80690910-80690932 TCCCCAGCAAAAGACTCAAAAGG + Intergenic
910193517 1:84618760-84618782 TGCCCAGCAGCATGCCCAAAAGG + Intergenic
912961313 1:114198071-114198093 CTCCCAGCCCAACACCCAGAAGG + Intergenic
920101582 1:203520232-203520254 GGCCCAGCTCCTCACCCAAAGGG - Intergenic
920204842 1:204283905-204283927 TGCCCAGCACCTCACACACAGGG + Intronic
922126856 1:222736263-222736285 TGCCCAGCTAGACACCCAGAAGG - Intergenic
922265451 1:223979651-223979673 TGCCCAGCAAAAGCTCCAAACGG + Intergenic
922729353 1:227941843-227941865 CGCCCAGCACAATGCACAAAGGG + Intronic
924074153 1:240315933-240315955 TCCCCAGTCCAACACACAAAAGG + Intronic
924665721 1:246069797-246069819 TGCCCACCACCAACCCCAAATGG - Intronic
1063393898 10:5668798-5668820 TGCCCACCACCACACCCAGCTGG + Intergenic
1063504782 10:6586799-6586821 AGTCCAGCACATCACCCAGAAGG + Intergenic
1064288588 10:14013562-14013584 TCCCCAGCAAAAAACCCACAAGG + Intronic
1065538417 10:26736933-26736955 TCCCCAGCATAACACCTACATGG - Intronic
1067221168 10:44345425-44345447 TGCCCAGCACAGCACCCTCCTGG - Intergenic
1067285978 10:44907987-44908009 TTCCCAACCCAGCACCCAAATGG + Intergenic
1067819418 10:49514374-49514396 TGCCCATACCAACACACAAAAGG + Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068880952 10:62048258-62048280 TGCCCAGCACAACACCCAAAAGG - Intronic
1070598425 10:77849079-77849101 TCCCCAGCAAAACACACATATGG + Intronic
1076428197 10:130382174-130382196 TGCACAGCACAGCACCCAGCGGG - Intergenic
1076911971 10:133394851-133394873 TGGCCATCACAACACCTAGACGG - Intronic
1077430577 11:2514033-2514055 TGACCTGCACACCCCCCAAATGG - Intronic
1079327478 11:19506557-19506579 TGCCAGGCACAACACTCAACTGG - Intronic
1081495165 11:43601937-43601959 TGCCCAGCCCCACCCCAAAATGG + Intronic
1083812065 11:65111795-65111817 GGCCCAGCACACCAGCCAATCGG - Exonic
1085886079 11:80523745-80523767 TGCCCTGCACAATCACCAAAGGG - Intergenic
1087423462 11:97962742-97962764 TGCCCAGGACAAAAACCTAAGGG + Intergenic
1089368227 11:117934115-117934137 TGCCCTGAACAAGACACAAAGGG - Intergenic
1089553410 11:119299700-119299722 TGCCCAGAACAACATCGAGATGG + Exonic
1089711750 11:120319987-120320009 TGCCCCCCACAACAACAAAAAGG - Intergenic
1090178436 11:124673011-124673033 TGACCTGCGCAACAGCCAAAGGG + Intronic
1093478604 12:19582174-19582196 TGCCCAGCAGAGCCCCCAGAAGG - Intronic
1093926530 12:24913784-24913806 GGTCCAGCACCACACCCAGAAGG - Intronic
1095693929 12:45122451-45122473 TCCCCAGCACAAGAAACAAAAGG - Intergenic
1095841926 12:46702612-46702634 TCCTCAGCACAAAACCCAAAAGG - Intergenic
1096491087 12:52013429-52013451 CGCCCAGCACCCCAGCCAAAGGG - Intronic
1096821452 12:54238719-54238741 TGCCCAGCCCAGCAATCAAAGGG + Exonic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1100129921 12:91479665-91479687 TACCCAGCATACCACCTAAATGG + Intergenic
1100289234 12:93198297-93198319 TGCCCAGCACACTGCCCTAATGG + Intergenic
1102248228 12:111368595-111368617 TCCCACGCACAACACACAAAGGG - Intronic
1103233686 12:119353752-119353774 TGCCCACCACCACACCCAGAGGG + Intronic
1108510684 13:51153026-51153048 TGCCCAGCCCCACACACAGAAGG + Intergenic
1109208910 13:59512337-59512359 TGTCCAGCACAGCACACACAAGG - Intergenic
1110358635 13:74599118-74599140 TGCCCATCAAGACACCCTAAAGG + Intergenic
1111049793 13:82866093-82866115 TCCCCTGCACAAAACTCAAATGG - Intergenic
1111129024 13:83950219-83950241 TGGTCAGCACAACATACAAAGGG + Intergenic
1112334991 13:98507312-98507334 ATCCCAGCTCAACAGCCAAAGGG + Intronic
1114779331 14:25520656-25520678 TGCCCAGCAGAAAAGTCAAATGG - Intergenic
1115262688 14:31469871-31469893 TGCCCTGCACACCACCCACCAGG - Intergenic
1117370396 14:55073231-55073253 TGCCCACCACCACACCCAGCTGG + Intergenic
1117731216 14:58723670-58723692 TGCCCAGGGCCACACACAAATGG - Intergenic
1119470740 14:74896944-74896966 TGATCAGCACAAGACCCAAAGGG - Intronic
1119604795 14:76006193-76006215 TGCTCAGCACAGCATCCACATGG - Intronic
1121582199 14:95039548-95039570 TGCCTGGCTCAAAACCCAAAAGG + Intergenic
1122937184 14:104965683-104965705 AGGCCAGCACACCACCCCAAAGG - Intronic
1123023628 14:105413398-105413420 TGCCCAGCTCATCACCCCCATGG - Exonic
1127846811 15:62877522-62877544 TGCCAACCCCAGCACCCAAACGG - Intergenic
1128565585 15:68698743-68698765 TCCTCATCACAACAGCCAAAGGG - Intronic
1129927845 15:79382097-79382119 TGCAGAGCACAAAACCCAGAAGG - Intronic
1131575635 15:93587830-93587852 TGCCCACCCCACCACTCAAATGG - Intergenic
1131581284 15:93646275-93646297 TGGCAAACACAACACACAAAGGG - Intergenic
1132658164 16:1049871-1049893 GGCCCAGCACAGCACCCAGTGGG - Intergenic
1132854643 16:2039302-2039324 GGCCCCACACAACACCCACACGG + Intergenic
1132986865 16:2771859-2771881 TGCCAAGCACAAGCCCCAAAAGG + Intronic
1135388902 16:22071625-22071647 TGTGCAGCATAACACACAAAAGG - Intronic
1138162910 16:54773113-54773135 TGCCCAGCATAGCAGCCAACTGG - Intergenic
1139440902 16:66966356-66966378 TGCCCGGCACCATCCCCAAAAGG - Intronic
1141800892 16:86308588-86308610 TGCGCAGCACAGCACAGAAAGGG - Intergenic
1143189892 17:5033528-5033550 TGCCCAGCACCACAGCCAGGTGG + Exonic
1143256563 17:5562065-5562087 TGCCCAGGGAAACACCCAGATGG + Intronic
1143449503 17:7027436-7027458 CGCCCGGCTCAACACCTAAAAGG + Intronic
1143598705 17:7930480-7930502 TGCCCAGAGCAACAGCCTAAAGG - Exonic
1145873512 17:28296906-28296928 TGCCCAGCACACCATCAGAAAGG - Intergenic
1148083585 17:44980793-44980815 TGCCCATCTCATCACCCACAGGG + Intergenic
1151330562 17:73404421-73404443 TGCTCAGCTCAACACACAACAGG + Intronic
1151388918 17:73772494-73772516 TGCCAAGCTAAACACCCAGAAGG + Intergenic
1151990743 17:77572456-77572478 TGGTCAGCTCCACACCCAAAAGG + Intergenic
1152467392 17:80474001-80474023 TGCCCAGCCTCACACCCAAGAGG - Intronic
1152735595 17:81995478-81995500 GGCCCAGCACAAAAGCCAAAGGG - Intronic
1154073733 18:11178964-11178986 TGCCCAGCACAACCCACAGCTGG + Intergenic
1156838754 18:41586541-41586563 TGCCCAGCAAATCACTGAAAAGG + Intergenic
1157228345 18:45889084-45889106 GCCCCAGCCCAACACACAAAAGG + Intronic
1157399588 18:47376443-47376465 TGCCCTGCACAACTCCCCGACGG + Intergenic
1160730879 19:641156-641178 TGCGGAGCACAGCACCCACAAGG - Intronic
1161186245 19:2922969-2922991 TGCCCTGCAGAACACCCTTAGGG + Intergenic
1167390256 19:49190239-49190261 TGGCCAGCACTACACCCATCTGG + Exonic
925556407 2:5135318-5135340 TGCCCCCTAAAACACCCAAAGGG - Intergenic
925596039 2:5556236-5556258 TGCACAGCACATCTCTCAAAGGG + Intergenic
927207833 2:20621224-20621246 TGTCCAGCACAGCACCCCCAGGG + Intronic
927340260 2:21975516-21975538 TGCCTAGCACAAAACCGAGATGG + Intergenic
928371372 2:30742390-30742412 TGACCAGCTCACCACTCAAAGGG + Intronic
928568844 2:32582379-32582401 TCCACAGCACACCACCTAAAAGG - Intronic
929373586 2:41256749-41256771 TGCCCAGCACAAAAGTCAAATGG - Intergenic
931212598 2:60212222-60212244 CACCCAAGACAACACCCAAAGGG + Intergenic
932509204 2:72268403-72268425 TGCCCAGCTCAACATATAAAAGG + Intronic
935078369 2:99768439-99768461 TTCCCAACACAACATACAAATGG + Intronic
936880121 2:117240321-117240343 TGCTCAGCATAACACCCCATAGG - Intergenic
945362544 2:208908608-208908630 TTCTCAGCAGAACACCTAAAAGG + Intergenic
945504900 2:210627934-210627956 TGTTCAGCACAACACCAAGAAGG - Intronic
947035235 2:225845685-225845707 TGCCTAGCTCTGCACCCAAAAGG + Intergenic
947055803 2:226101851-226101873 TACCGAGCACAACATACAAATGG - Intergenic
947265042 2:228269199-228269221 TACCCAGCACAAGTCCCTAAAGG - Intergenic
948146328 2:235710806-235710828 TGCCCATCACAGCACCCGAGTGG - Intronic
948861144 2:240753121-240753143 TACCCAGGACCACACCCAGAGGG + Intronic
1169949298 20:11025398-11025420 TGTCCAGCACAAAGCTCAAAAGG + Intergenic
1172297691 20:33825000-33825022 TCCCCAGCAGAACAACAAAAGGG - Intronic
1174450345 20:50616239-50616261 TGCCCAGCACCACACAAAATTGG + Intronic
1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG + Intronic
1178891728 21:36525673-36525695 TGCCCAGCACACCACACATGTGG - Intronic
1179397176 21:41051419-41051441 TTCCCAACACAACACCCTAGGGG + Intergenic
1179419791 21:41226366-41226388 GGCCCAGCACACCAGCCAAGGGG - Intronic
1179809422 21:43860876-43860898 TGCCCACCTCCACACCCAGAAGG - Intergenic
1181089080 22:20459771-20459793 TGCTCAGCACTACATCCAGAGGG + Intronic
1183890931 22:40927973-40927995 TGCGCAGCACAACAGCTAAAAGG - Exonic
1184103073 22:42351792-42351814 TCCCCTGCAGAACAACCAAAGGG - Intergenic
953112926 3:39960896-39960918 TGCACAGCACAACACTCATGAGG - Intronic
956399461 3:68861677-68861699 AGCCCAGCTCAACACCCTCAGGG + Intronic
962410081 3:135133266-135133288 TGCCCAGCACAAAAGCAAAGAGG + Intronic
967228460 3:187315309-187315331 AGCCCATCACAAAACCCTAAAGG + Intergenic
978532184 4:109726580-109726602 TTCTCAGCACAACAGCCAGAGGG + Intronic
980078330 4:128317890-128317912 TGCCCACCAGAATACCCTAAAGG + Intergenic
989008631 5:36844078-36844100 TGCCCAGCACAACAAGTAATTGG + Intergenic
991471118 5:66970093-66970115 TCCCCAGCCCCACACCCACAGGG - Intronic
994946802 5:106404532-106404554 TGCCTACCACACCAGCCAAATGG - Intergenic
996378606 5:122841551-122841573 TACACAGCACAATACTCAAAAGG - Intergenic
1005696173 6:28354720-28354742 TGCCCGCCCCAACACCCTAAAGG - Intronic
1006445952 6:34079902-34079924 TTCCCTGCACAACAGCCAGAGGG + Intronic
1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG + Intronic
1006893693 6:37452054-37452076 GGGACAGCACAACACCCACAGGG - Intronic
1007112616 6:39321736-39321758 TTGCCAGCACTGCACCCAAATGG - Intronic
1007994208 6:46288869-46288891 TGCCTAGTACAACACCCAACAGG + Intronic
1011045820 6:83081398-83081420 TGCCCAGCCCTACAACCAACTGG + Intronic
1013617739 6:111860364-111860386 TGCCCACCAAAACACCCATGGGG - Intronic
1021377484 7:19925645-19925667 TGCCCAGTCCAACACACAACAGG - Intergenic
1022188392 7:27992622-27992644 TCTCCAGCACAGCACCAAAAAGG + Intronic
1022514795 7:30968780-30968802 AGCCCAGAAAGACACCCAAATGG + Intronic
1023148392 7:37175543-37175565 TGCCCAACTCAAAACCCAACAGG + Intronic
1023151752 7:37207973-37207995 TTCTCAGCACAACATCCCAATGG - Intronic
1024606202 7:51024536-51024558 AGACCAGCACAAGACCAAAATGG + Intronic
1024988520 7:55216643-55216665 TGCATAGCACAAAACCCCAAAGG + Intronic
1029531203 7:101126554-101126576 GGCCCAGCCCAACAGCCACAGGG - Intergenic
1030922847 7:115414136-115414158 GGCCCAGAAAATCACCCAAAAGG + Intergenic
1032560315 7:132884124-132884146 TGCCCAACACAGCAGCCAGAGGG + Intronic
1036393768 8:8349002-8349024 TGCCCAGCAAAACTTGCAAAAGG + Intronic
1037166209 8:15832093-15832115 TGCTCAGCAGAAAACCCACAAGG + Intergenic
1038125469 8:24668479-24668501 TGATCCTCACAACACCCAAAAGG - Intergenic
1039579085 8:38649414-38649436 TGCCCAGCACCAAAGCCACATGG - Intergenic
1040605992 8:48931761-48931783 TGCTGAGCACAACAGCCATAAGG + Intergenic
1045233753 8:100331114-100331136 TGCCCAGCACCTGACCCATATGG - Intronic
1046876727 8:119263005-119263027 TGACCCACACAACACACAAATGG - Intergenic
1049767205 8:144360422-144360444 TGCCCAGCACCACAGCCAGGTGG - Exonic
1049812953 8:144583945-144583967 TGTCCAGCACATCACTCAAGGGG + Intronic
1050074616 9:1850481-1850503 TGTCCAGAAAAACACCAAAATGG - Intergenic
1051549362 9:18311974-18311996 TGCCCAGAACAGCACGTAAAAGG - Intergenic
1055674983 9:78648929-78648951 AGACCAGTACAACATCCAAATGG + Intergenic
1056849746 9:90072496-90072518 GGACCAGCACAGCACCCAGAGGG - Intergenic
1057502269 9:95605178-95605200 TCACCAGGACAAAACCCAAAAGG + Intergenic
1058638923 9:107064331-107064353 TGCCCACCACATCACCCAGGGGG + Intergenic
1058817378 9:108696998-108697020 TGCTCAGCAAAACACATAAACGG - Intergenic
1062103336 9:134739527-134739549 CACCCACCACAACACCCACAGGG - Intronic
1062694778 9:137867832-137867854 TGTCCTGCCCACCACCCAAAGGG - Intronic
1189555648 X:42142541-42142563 TGCCATACACAACACCCAAATGG + Intergenic
1190224918 X:48537975-48537997 TGCCCAGCAGAGCATGCAAAAGG - Intergenic
1199715838 X:150506841-150506863 TGCCCAGCACACAACCCCCAGGG + Intronic
1200856122 Y:7940417-7940439 TGCTTGGCACAACACCTAAATGG - Intergenic
1201018055 Y:9624779-9624801 AGCCAAGCACAACACACACAAGG + Intergenic
1202259886 Y:22959246-22959268 TGCTTGGCACAACACCTAAATGG + Intergenic
1202412872 Y:24592990-24593012 TGCTTGGCACAACACCTAAATGG + Intergenic
1202457909 Y:25077080-25077102 TGCTTGGCACAACACCTAAATGG - Intergenic