ID: 1068881231

View in Genome Browser
Species Human (GRCh38)
Location 10:62051161-62051183
Sequence CACGGCAACCAGGGGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068881231_1068881244 -7 Left 1068881231 10:62051161-62051183 CCTCCCTTCCCCTGGTTGCCGTG 0: 1
1: 1
2: 3
3: 20
4: 207
Right 1068881244 10:62051177-62051199 TGCCGTGGGCTGGGGGAGGTAGG 0: 1
1: 1
2: 15
3: 171
4: 1523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068881231 Original CRISPR CACGGCAACCAGGGGAAGGG AGG (reversed) Intronic
900910404 1:5593405-5593427 CACGACAAGTTGGGGAAGGGTGG - Intergenic
901600033 1:10416484-10416506 CACAGCAACCAGAAGAAAGGTGG - Intronic
902536163 1:17120233-17120255 CTGGGCCACCAAGGGAAGGGGGG + Intergenic
903791945 1:25899124-25899146 CAGGGCCACCATGGGATGGGTGG + Intronic
904521520 1:31099732-31099754 CAAGGAAAGCAGGGGAAGGGAGG - Intergenic
904747681 1:32720954-32720976 CACGGAAACCAGTGAGAGGGAGG + Intergenic
905417703 1:37815660-37815682 CATGGGAACCATGGGAAGGATGG + Intronic
905506914 1:38487203-38487225 CATGGTTACCAGGGGCAGGGAGG - Intergenic
905920431 1:41715421-41715443 CACGGCAAGCCTGGGGAGGGTGG + Intronic
906509146 1:46401039-46401061 GAGGGAAACCAGGGGAGGGGAGG + Intronic
908849812 1:68364351-68364373 CACTGCATGCAGGGGAAGGGTGG + Intergenic
909227489 1:73044313-73044335 CACTGCATCCAGGGGCATGGGGG + Intergenic
915310848 1:155005173-155005195 CTTGGCACCCTGGGGAAGGGTGG + Intronic
917360604 1:174171643-174171665 CACAGTTACCAGGGGAAAGGAGG - Intronic
918379214 1:183937676-183937698 CACGGCACCCGGGGGAGTGGTGG - Exonic
920048438 1:203148798-203148820 CACTGCAGCCAGGGGAGGGGCGG - Intronic
921478445 1:215636632-215636654 CACAGCACGCAGGGGAAGGGAGG + Intronic
922517856 1:226222159-226222181 CACTGCAACCAAGAGAAGAGGGG + Intergenic
922584539 1:226723661-226723683 CAGAGGAACAAGGGGAAGGGAGG + Intronic
924601913 1:245498471-245498493 CACAGCAACCAGCAGAAGTGAGG + Intronic
1063551025 10:7033374-7033396 TACAGCAATCAGGTGAAGGGAGG - Intergenic
1066818845 10:39456609-39456631 CACGGGAGCCAGAGGCAGGGAGG + Intergenic
1067100098 10:43328883-43328905 CACGGGAGCCCGGGGCAGGGAGG - Intergenic
1068881231 10:62051161-62051183 CACGGCAACCAGGGGAAGGGAGG - Intronic
1068967711 10:62929433-62929455 CACGGGAACCCGAGGCAGGGAGG + Intergenic
1069754382 10:70764238-70764260 CACAGCAGGCAGGGGAAGAGGGG + Intergenic
1070493214 10:76996639-76996661 CACGGCAAGCATGGGAAGATGGG + Intronic
1070667859 10:78358222-78358244 GACTGCAAGCAGGGAAAGGGTGG - Intergenic
1071138400 10:82478666-82478688 CACGGCAACCATCGGAAAGGTGG + Intronic
1072396571 10:95049390-95049412 CACTGCTGCCAGGGGAAGAGAGG - Intronic
1072533201 10:96338989-96339011 GAGGGCACCCAAGGGAAGGGAGG + Intergenic
1072610922 10:97017265-97017287 CAAGGCAACCAGGGGAAGAGAGG + Intronic
1075288089 10:121204488-121204510 GAAGCCAACCAGGGGGAGGGAGG + Intergenic
1077377221 11:2210747-2210769 CATGGAAGTCAGGGGAAGGGAGG - Intergenic
1077611375 11:3645115-3645137 CATGGCCACCAGGAGAGGGGAGG - Exonic
1078002945 11:7512735-7512757 CACAGCCAGCAGGGGAAGGCTGG - Intergenic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1079351325 11:19694425-19694447 CAGGGAAGCCAGGGGAGGGGAGG + Intronic
1080590781 11:33721651-33721673 TCCAGCAACCAGGGGAGGGGTGG + Intronic
1080642549 11:34166211-34166233 CCTGGTATCCAGGGGAAGGGCGG - Intronic
1083106250 11:60361122-60361144 CATGTAAAACAGGGGAAGGGTGG + Intronic
1083234770 11:61344321-61344343 CAGGGAAACAAGTGGAAGGGGGG - Intronic
1083365354 11:62138775-62138797 GACGGCTGCCTGGGGAAGGGAGG + Intronic
1083719391 11:64596869-64596891 CACGTCTACCAAGGAAAGGGGGG - Intronic
1083759904 11:64810136-64810158 CAAGGCAAGCCGGGGGAGGGAGG + Intronic
1083859327 11:65411581-65411603 CCCAGCATCCGGGGGAAGGGAGG - Exonic
1083924795 11:65799374-65799396 CAAAGCAACCAAGGGCAGGGTGG + Intergenic
1084372031 11:68750996-68751018 AGCGGCGACCAGGGGAGGGGCGG + Intronic
1085054916 11:73397905-73397927 CCTGGCAGCCAGGGGAGGGGTGG + Intergenic
1089066251 11:115664270-115664292 CAAGTTAACCAGGGGAAGGCAGG - Intergenic
1089787910 11:120921338-120921360 CTCAGCCACCAGGGGATGGGTGG + Intronic
1090027365 11:123179416-123179438 CAAGGAAGCCTGGGGAAGGGTGG + Intronic
1090177707 11:124665859-124665881 CATGCCAACCAGGGGCAGGGAGG + Intronic
1092290413 12:7156883-7156905 CAAGCCCACCAGGAGAAGGGAGG + Intronic
1093414800 12:18907785-18907807 CATGGCAAGCACGGGAAGTGGGG + Intergenic
1095190969 12:39257501-39257523 CCCTGCAAGCATGGGAAGGGAGG - Intergenic
1097626659 12:62010252-62010274 CACGGGAGCCCGGGGCAGGGAGG - Intronic
1098022974 12:66174500-66174522 CACGGGAGCCTGGGGCAGGGAGG - Intergenic
1098370448 12:69754070-69754092 CACAGCAACCAGGACAAGGGAGG + Intronic
1101740281 12:107495032-107495054 CTCAGCAACCAGGGGAAGGTAGG + Intronic
1101942608 12:109111154-109111176 CACCGCAGCCAGGGGAGGGTTGG - Intergenic
1102349592 12:112182611-112182633 CACTTGAACCAGGGGAAGGCTGG + Intronic
1102419321 12:112791568-112791590 AACGGCAACCAGGGGATTGGCGG - Intronic
1103776726 12:123371768-123371790 CACGGGAGCCCGGGGCAGGGAGG - Intergenic
1105690929 13:22838395-22838417 CATGACAACCAGGGGAGGGGGGG + Intergenic
1106242510 13:27922357-27922379 GACGGCTTCCAGGGGAAGAGAGG - Intronic
1107383071 13:39877631-39877653 CATGGCAAAGAGGGGAAGGTGGG - Intergenic
1107806459 13:44158140-44158162 CATGGGAACAAGGGAAAGGGAGG - Intronic
1112250463 13:97774555-97774577 CACGGCAGCCTGAGGCAGGGAGG - Intergenic
1113048699 13:106184901-106184923 CACTGCAACCAGGAGGATGGGGG - Intergenic
1113652505 13:112045425-112045447 AATGGAAAACAGGGGAAGGGAGG + Intergenic
1117451947 14:55860214-55860236 TACAGCTACCAGGGGGAGGGGGG - Intergenic
1117548114 14:56809346-56809368 CACGACAACCGGGGGTTGGGAGG + Intronic
1119613622 14:76083959-76083981 CAGAGCACCCACGGGAAGGGAGG - Intronic
1121180187 14:91923065-91923087 TATGACAACCAGGTGAAGGGTGG - Intronic
1121739345 14:96240509-96240531 AACAGCACCCAGAGGAAGGGGGG - Exonic
1123987474 15:25658252-25658274 CTCAGCAACCAGGGACAGGGAGG + Intergenic
1124102950 15:26712753-26712775 CACGGCCACCTCGGGAAGGTGGG + Intronic
1127017868 15:54708567-54708589 GTCGGCAACCAGGGGTTGGGCGG + Intergenic
1128968620 15:72086501-72086523 CAGTACAACCAGGGGAAGGGAGG + Intronic
1130064639 15:80593771-80593793 CAGGGCAAGCAGGGCGAGGGTGG - Exonic
1130102680 15:80905851-80905873 CACCGACACCAGAGGAAGGGTGG + Intronic
1131360604 15:91787427-91787449 CATGGCAACCAGGTGAACTGGGG - Intergenic
1132500585 16:283034-283056 CCCGGCCCCCAGGGGAGGGGAGG - Intergenic
1136254546 16:29029404-29029426 CCCGGCAGCCGGGGGAGGGGTGG + Intergenic
1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG + Exonic
1138005345 16:53330698-53330720 CATGGACACCAGGGGAGGGGGGG - Intergenic
1138204430 16:55114530-55114552 CAAGGGAACCAGGGGAGGGGTGG - Intergenic
1138457722 16:57130965-57130987 CACGGGCACCAGGGGAGGGGTGG + Intronic
1141371095 16:83486988-83487010 CAAGGGAAGGAGGGGAAGGGAGG + Intronic
1141704645 16:85658181-85658203 CAGGGCAGGCAGGGGCAGGGAGG - Intronic
1142423614 16:89988705-89988727 AATGCCAACCAGGAGAAGGGTGG - Intergenic
1143353977 17:6310854-6310876 AATGGCCACCAGAGGAAGGGAGG - Intergenic
1143378002 17:6478652-6478674 GATGGCCAACAGGGGAAGGGCGG + Exonic
1143565443 17:7717712-7717734 CATGGCAACCCCGGGCAGGGAGG - Exonic
1143612751 17:8029117-8029139 CACAACAACCAGGAGAAGAGAGG - Intergenic
1144384449 17:14736506-14736528 CTTGGCAATTAGGGGAAGGGAGG + Intergenic
1144599811 17:16601544-16601566 AGAGGCAACTAGGGGAAGGGCGG + Intergenic
1144738206 17:17566618-17566640 CAAGGCAGCCAGGTGAAGGCGGG + Intronic
1147498089 17:40936848-40936870 CCGGGTTACCAGGGGAAGGGAGG - Exonic
1147906333 17:43825500-43825522 AAAGGGAACCAGGGGAAGGAAGG + Intronic
1148681995 17:49479482-49479504 CAGGAGAGCCAGGGGAAGGGCGG + Intergenic
1148837026 17:50470669-50470691 TAAGGCAGCCAGGGGATGGGGGG + Intronic
1148853479 17:50566031-50566053 CATGGTAACCAAGGGAACGGGGG - Intronic
1149342236 17:55698985-55699007 CAGGGAGGCCAGGGGAAGGGAGG + Intergenic
1151652509 17:75478809-75478831 CACCACACCAAGGGGAAGGGAGG - Intronic
1151746366 17:76013932-76013954 CATGGCAGTCAGGGGAAAGGAGG - Intronic
1152014202 17:77739080-77739102 CACTGCCACCATGTGAAGGGTGG - Intergenic
1152656801 17:81523614-81523636 CACGGGGACAAGGGGGAGGGTGG + Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153643084 18:7172358-7172380 CACAGCAACAAGGAGAAGGCCGG - Intergenic
1153657847 18:7301275-7301297 CAAGAAAACCTGGGGAAGGGTGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1158273610 18:55742724-55742746 CACCAAAACCAGGGGAAGGAAGG + Intergenic
1158889558 18:61860125-61860147 CACGAGAAGCTGGGGAAGGGAGG + Intronic
1159105255 18:63996995-63997017 CATGGGGTCCAGGGGAAGGGAGG - Intronic
1161667601 19:5586553-5586575 CTTGGCAGCCAGGGGAGGGGCGG + Intergenic
1164260882 19:23567957-23567979 CACGGGAGCCCGGGGCAGGGAGG - Intronic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1166961018 19:46495775-46495797 CACCGCAGCCAGGTGCAGGGGGG + Exonic
1167019031 19:46860947-46860969 GGCGGCAACCAGGGGGAGGGCGG - Intergenic
1167295411 19:48646432-48646454 CTCCGCAGCAAGGGGAAGGGGGG + Intergenic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
930124083 2:47783021-47783043 CGCGGCGACGTGGGGAAGGGCGG - Intronic
930858669 2:56045930-56045952 CAGGGGAACCAGGTGAAGTGTGG + Intergenic
931857466 2:66318243-66318265 CAGGCCAACCAGGGGTGGGGAGG + Intergenic
933869319 2:86550290-86550312 CACGGGAGCCCGGGGCAGGGAGG + Intronic
934846404 2:97663814-97663836 CCCGGCAGCCAGGGGGAGGGCGG - Intronic
936146104 2:109981523-109981545 CACGGCAGTCAGGGGAAAGCAGG - Intergenic
936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG + Intergenic
936533045 2:113290280-113290302 CACCCCGACCATGGGAAGGGAGG + Intergenic
937297762 2:120820026-120820048 CATGGGAACCTGGGGAAGGTTGG + Intronic
938289283 2:130140939-130140961 CAGGACCCCCAGGGGAAGGGAGG + Intronic
938467244 2:131531999-131532021 CAGGACCCCCAGGGGAAGGGAGG - Intronic
942386233 2:175446364-175446386 CAGGACAGCCAGGGGAAGGAGGG - Intergenic
942653906 2:178194945-178194967 CCTGGCAACGAGGGGGAGGGAGG - Intronic
943418681 2:187638055-187638077 CACGGGAGCCCGGGGCAGGGAGG + Intergenic
943800941 2:192056825-192056847 CATGGCAAAAAGGGCAAGGGAGG - Intronic
946948065 2:224843005-224843027 CAGACCAACAAGGGGAAGGGGGG + Intronic
947064760 2:226210688-226210710 CAAGACAACCAGGTGGAGGGAGG - Intergenic
947916041 2:233832336-233832358 CCCGGCACTCGGGGGAAGGGTGG + Intronic
1168956853 20:1840533-1840555 CACAGCATCCAGGGGAAGGGTGG + Intergenic
1169269363 20:4187450-4187472 CACGGCAGCAAGGGGCAGGCTGG - Exonic
1169806255 20:9562511-9562533 CAAGGATACCAGGGGAAGGAAGG - Intronic
1171810970 20:29743919-29743941 CAGGGACACCTGGGGAAGGGAGG + Intergenic
1172276952 20:33685238-33685260 CATGGCAACCAGGGCCTGGGAGG + Intronic
1173048289 20:39533855-39533877 GACGGTTACCAGGGGCAGGGAGG - Intergenic
1173574266 20:44100535-44100557 CAGGTAGACCAGGGGAAGGGAGG + Intergenic
1174870137 20:54174096-54174118 CGCGGGACCCAGGGGAGGGGGGG + Intergenic
1175295501 20:57906151-57906173 CACGGCACCCAGGTAAAGAGGGG - Intergenic
1176512476 21:7759132-7759154 CACTGGAACCAAGGGCAGGGAGG + Intronic
1178646589 21:34389656-34389678 CACTGGAACCAAGGGCAGGGAGG + Intronic
1179951386 21:44710613-44710635 CACGGCTATCAGGGGAGGCGAGG - Intronic
1181443212 22:22949284-22949306 CAGGGCAACCAGGGGCAGGGTGG + Intergenic
1181959213 22:26610836-26610858 CAAGGCAAACAGGGGAAGTCAGG + Intronic
1182095694 22:27623848-27623870 CAGGGCATAAAGGGGAAGGGAGG - Intergenic
1183058951 22:35323647-35323669 ACCGGGAACCAAGGGAAGGGAGG + Intronic
1184017276 22:41795625-41795647 CACAGCAACCAAGGAATGGGAGG + Intronic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952905867 3:38138753-38138775 GAGAGCAGCCAGGGGAAGGGAGG - Exonic
953796807 3:45992224-45992246 CAAGGCAACCTGGGGAGGGGAGG + Intronic
955716457 3:61835365-61835387 CACTCCAGCCTGGGGAAGGGGGG - Intronic
958602497 3:96315390-96315412 GTGGGCAACTAGGGGAAGGGGGG - Intergenic
961373297 3:126445743-126445765 CAGGGCAGCCAGGGGAGGAGGGG + Intronic
961772414 3:129259728-129259750 CCGGGCAGCCAGGGCAAGGGAGG + Intronic
961872059 3:129995853-129995875 CAGGGAAGCCATGGGAAGGGTGG + Intergenic
962280523 3:134048672-134048694 CACGGCAAACAGGGGAAGGGTGG - Intronic
962381632 3:134903012-134903034 AAGGGCAACCTGCGGAAGGGTGG - Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
965360692 3:167735121-167735143 CACGGAAAGGAGAGGAAGGGCGG + Intergenic
967993726 3:195151078-195151100 CAGGGAAACCAGGGTAAGAGAGG - Intronic
968130140 3:196188441-196188463 CAGGGCACCCAGGGGCAAGGAGG + Intergenic
968547257 4:1205631-1205653 TACGGCAGCCTTGGGAAGGGTGG + Intronic
969533574 4:7742200-7742222 GACTGCAAGCAGGGGAATGGGGG - Exonic
969988154 4:11233135-11233157 CAAGCATACCAGGGGAAGGGAGG - Intergenic
971393992 4:26212001-26212023 CACAGAAGCCAGGGGAAGTGTGG + Intronic
975379599 4:73683605-73683627 CACAGCAATCAGGGGAAGTTGGG + Intergenic
979126029 4:116972481-116972503 AACTGCAACCATGGAAAGGGGGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
981296709 4:143140900-143140922 CACAGCACCTGGGGGAAGGGGGG + Intergenic
981629749 4:146804772-146804794 CACAGCACCTCGGGGAAGGGAGG + Intronic
982358287 4:154491966-154491988 CACGGCAGGGAGGGGAAGGCAGG - Intergenic
985544994 5:504999-505021 CAGGGAAAGCAGGGGAGGGGTGG - Intronic
992431284 5:76714131-76714153 GATGGCAACTAGGGGAGGGGAGG + Intergenic
997998385 5:138604712-138604734 CAGGGCAACCTGGTGAGGGGAGG - Intergenic
1001955977 5:175848377-175848399 CAAGTCAACCAGGGGACAGGAGG + Intronic
1001956047 5:175848876-175848898 CTTGGCAACCCGGGGAAGGCAGG + Intronic
1003654808 6:7996768-7996790 GGCGGCAAAGAGGGGAAGGGTGG - Intronic
1009367973 6:62870368-62870390 CACAGTATCCAGGGGAAGGGAGG + Intergenic
1009844915 6:69122363-69122385 CACGGGAGCCCGGGGCAGGGAGG + Intronic
1009994623 6:70884515-70884537 CAAGGCGGCCAGGGGCAGGGAGG + Intronic
1015219478 6:130787829-130787851 GAGAGTAACCAGGGGAAGGGAGG - Intergenic
1018623228 6:165751542-165751564 CAAGGCAACCAGGTGGAGGTAGG + Intronic
1018853591 6:167659155-167659177 CACTGCAGCCAGAAGAAGGGAGG - Intergenic
1019340010 7:504497-504519 CAGGGCCTCCAGGGGAGGGGAGG - Intronic
1029501092 7:100930350-100930372 CAAGGCAACCAGGTGAACTGAGG - Intergenic
1033241136 7:139680932-139680954 CACGAAAACCAGGGGCGGGGAGG - Intronic
1034499479 7:151440435-151440457 CAGAGCAGCCAGGGGAGGGGCGG - Intronic
1039775380 8:40731161-40731183 CCCTCCAACCAGGGGAAGTGGGG - Intronic
1041426363 8:57725202-57725224 CAGGGCAGCCAGGAGAACGGAGG + Intergenic
1045432243 8:102124499-102124521 CAGGGCAAGCGGGGGAGGGGGGG - Intronic
1045905221 8:107337159-107337181 CACAGGAACCAAGGGAAGAGTGG + Intronic
1047599558 8:126412687-126412709 CATGGCAAAAAGTGGAAGGGGGG - Intergenic
1048168952 8:132086914-132086936 CAAGGCACCAAGGGGAAGGCAGG + Intronic
1048229092 8:132619684-132619706 AAGGAAAACCAGGGGAAGGGAGG + Intronic
1048986610 8:139738204-139738226 CACGGCAGCCCGTGGTAGGGGGG + Intronic
1049007324 8:139863715-139863737 CACGTCAACGTGGGGAAGGCAGG + Intronic
1049306236 8:141905836-141905858 CCCGGAAGCCAGGGGCAGGGCGG - Intergenic
1049427386 8:142543514-142543536 CCCGGCAGCCAGGGGACGGGCGG + Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049743851 8:144254738-144254760 CACGGCACCCAGGTGGCGGGGGG + Intronic
1050519683 9:6484452-6484474 CACTGCATCCAGGAGGAGGGGGG - Intronic
1050948009 9:11550293-11550315 CATGGCAAGCAGGGGATGGGAGG - Intergenic
1051746196 9:20297428-20297450 GATGGAAACCAGGGGAAGGTGGG + Intergenic
1053082072 9:35184622-35184644 CACGGGAGCCCGGGGCAGGGAGG + Intronic
1053131614 9:35618679-35618701 CAAGGCAGCCAGGAGGAGGGTGG - Intronic
1053138678 9:35668151-35668173 CATGGAAACCAGGGCAATGGCGG + Intronic
1057804518 9:98210842-98210864 CACTGCAAACAGGGAAAGGCTGG + Exonic
1059453866 9:114387684-114387706 CCCGGCCTCCAGGGCAAGGGTGG - Intronic
1059716578 9:116918635-116918657 CAAGGCAAACAGTGGAAAGGAGG - Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060202359 9:121658854-121658876 CACAGGAACCTGGCGAAGGGAGG - Intronic
1060775526 9:126371157-126371179 GTCGGCACCCAGGGGAAGGCCGG - Intronic
1061615271 9:131775005-131775027 AACGGCAGCCAGGAGAAGGCAGG + Intergenic
1190949334 X:55127497-55127519 CAAGGATACCAGGGGAAAGGAGG - Intronic
1192452082 X:71251011-71251033 CATGGGAACCAGGGGCAGTGGGG - Intronic
1196364683 X:114911332-114911354 CACTACTACCAGTGGAAGGGAGG + Intergenic
1198777316 X:140193735-140193757 CACTTCAACCTGGAGAAGGGGGG + Intergenic
1199685655 X:150263053-150263075 CACGGCAACCAGGTGGAGGCAGG - Intergenic
1200018035 X:153180437-153180459 CACGGAAGCCACGGGAATGGCGG + Intronic