ID: 1068884092

View in Genome Browser
Species Human (GRCh38)
Location 10:62080578-62080600
Sequence CCAAATATGGAGCCAATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068884092_1068884098 27 Left 1068884092 10:62080578-62080600 CCTTCTATTGGCTCCATATTTGG No data
Right 1068884098 10:62080628-62080650 TAAAGTTATATTTTAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068884092 Original CRISPR CCAAATATGGAGCCAATAGA AGG (reversed) Intronic
No off target data available for this crispr