ID: 1068886875

View in Genome Browser
Species Human (GRCh38)
Location 10:62106836-62106858
Sequence AGTTGGGAAAATATTTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068886872_1068886875 5 Left 1068886872 10:62106808-62106830 CCTCAACTAAGAGAAGAAACGAG No data
Right 1068886875 10:62106836-62106858 AGTTGGGAAAATATTTATAATGG No data
1068886871_1068886875 6 Left 1068886871 10:62106807-62106829 CCCTCAACTAAGAGAAGAAACGA No data
Right 1068886875 10:62106836-62106858 AGTTGGGAAAATATTTATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068886875 Original CRISPR AGTTGGGAAAATATTTATAA TGG Intergenic
No off target data available for this crispr