ID: 1068887404

View in Genome Browser
Species Human (GRCh38)
Location 10:62111699-62111721
Sequence CAGCTCTGCAACTCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068887404_1068887408 -8 Left 1068887404 10:62111699-62111721 CCAGCTTGTGAGTTGCAGAGCTG No data
Right 1068887408 10:62111714-62111736 CAGAGCTGGGACTTGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068887404 Original CRISPR CAGCTCTGCAACTCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr