ID: 1068892792

View in Genome Browser
Species Human (GRCh38)
Location 10:62165137-62165159
Sequence ATCCTGGTGGAGATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068892792_1068892799 14 Left 1068892792 10:62165137-62165159 CCAAGCTCCATCTCCACCAGGAT No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068892792 Original CRISPR ATCCTGGTGGAGATGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr