ID: 1068892799

View in Genome Browser
Species Human (GRCh38)
Location 10:62165174-62165196
Sequence ACAGTCCCTGATATTAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068892794_1068892799 7 Left 1068892794 10:62165144-62165166 CCATCTCCACCAGGATGCCAGGT No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data
1068892789_1068892799 19 Left 1068892789 10:62165132-62165154 CCAGCCCAAGCTCCATCTCCACC No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data
1068892797_1068892799 -10 Left 1068892797 10:62165161-62165183 CCAGGTCCTTAGCACAGTCCCTG No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data
1068892788_1068892799 20 Left 1068892788 10:62165131-62165153 CCCAGCCCAAGCTCCATCTCCAC No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data
1068892792_1068892799 14 Left 1068892792 10:62165137-62165159 CCAAGCTCCATCTCCACCAGGAT No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data
1068892796_1068892799 -2 Left 1068892796 10:62165153-62165175 CCAGGATGCCAGGTCCTTAGCAC No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data
1068892791_1068892799 15 Left 1068892791 10:62165136-62165158 CCCAAGCTCCATCTCCACCAGGA No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data
1068892795_1068892799 1 Left 1068892795 10:62165150-62165172 CCACCAGGATGCCAGGTCCTTAG No data
Right 1068892799 10:62165174-62165196 ACAGTCCCTGATATTAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068892799 Original CRISPR ACAGTCCCTGATATTAAGTA AGG Intergenic
No off target data available for this crispr