ID: 1068895175

View in Genome Browser
Species Human (GRCh38)
Location 10:62190960-62190982
Sequence TAGTAGTCATAGAAGTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068895175_1068895180 15 Left 1068895175 10:62190960-62190982 CCTTTCCACTTCTATGACTACTA 0: 1
1: 0
2: 0
3: 10
4: 169
Right 1068895180 10:62190998-62191020 CTGCAAAATGAAACTCCTCCAGG No data
1068895175_1068895181 25 Left 1068895175 10:62190960-62190982 CCTTTCCACTTCTATGACTACTA 0: 1
1: 0
2: 0
3: 10
4: 169
Right 1068895181 10:62191008-62191030 AAACTCCTCCAGGAACCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068895175 Original CRISPR TAGTAGTCATAGAAGTGGAA AGG (reversed) Intronic
903924599 1:26823027-26823049 TGTTAGTCATAGTAGAGGAAAGG + Intergenic
908975510 1:69892292-69892314 TGGTAGAAATAAAAGTGGAAAGG + Intronic
909434275 1:75622293-75622315 TAGTAGTAATAGTAGTGTTATGG - Intergenic
909462553 1:75934574-75934596 AACTAGCCATAGAAATGGAAAGG - Intergenic
910669102 1:89755558-89755580 GAGGAGGAATAGAAGTGGAATGG - Intronic
913356878 1:117931583-117931605 TAGTATTCATGTAGGTGGAAAGG + Intronic
915099198 1:153486331-153486353 TAGCAGTGAGAGAACTGGAAAGG - Intergenic
919138049 1:193535343-193535365 TAGTAGTGATAGAGGAAGAATGG - Intergenic
921275021 1:213510845-213510867 AAGTAGTCACAGAAGTAAAAAGG - Intergenic
921487287 1:215730125-215730147 TAGAAGTAAGAGAAATGGAATGG + Intronic
1064656008 10:17556877-17556899 TATAAATCTTAGAAGTGGAATGG - Intergenic
1068895175 10:62190960-62190982 TAGTAGTCATAGAAGTGGAAAGG - Intronic
1069037104 10:63657005-63657027 TAATAATTATAGAAGTAGAATGG + Intergenic
1074114661 10:110446789-110446811 AAGTAGTCAGCGAAGTGGCATGG - Intergenic
1074762755 10:116679551-116679573 TAGTAGTCAATGAAGGAGAAGGG + Exonic
1075488921 10:122849603-122849625 TAGCAATCATAGAAGAGGAAAGG - Intronic
1075495038 10:122912579-122912601 TAGCAGTCGTAGGAGAGGAAGGG + Intronic
1076034242 10:127185668-127185690 TAGGAATTAGAGAAGTGGAAAGG + Intronic
1078324511 11:10368839-10368861 TAGGAGGCATTGCAGTGGAAGGG + Intronic
1086202655 11:84222406-84222428 TTGTAGTCATAGATGTAAAAAGG - Intronic
1086331986 11:85763321-85763343 TAGTATTCATAGATGTGGCATGG - Intronic
1091953031 12:4611058-4611080 TAGGACTGATAGAACTGGAAGGG - Intronic
1092531071 12:9345961-9345983 TAGTATTCAAAGAACTGGAGTGG - Intergenic
1094699877 12:32859027-32859049 TGGTAGAAATAGAAGTGCAAAGG - Intronic
1097772315 12:63602226-63602248 TATTAGACATAGAAAGGGAATGG + Intronic
1100500269 12:95167154-95167176 TAATAGTCAAAAAAGTAGAAAGG - Intronic
1103522072 12:121543004-121543026 TAGGAGTAATAGGAGTGGAGTGG - Intronic
1105595987 13:21838516-21838538 TCCTCGTCATAGAATTGGAATGG - Intergenic
1108170190 13:47733530-47733552 TAGTTGTGATAGAAGCTGAATGG - Intergenic
1108538664 13:51414246-51414268 TAGTAGTCAGGGAAGTGGAGTGG - Intronic
1108927216 13:55768149-55768171 AAGTAGTGATAGGAGGGGAAGGG + Intergenic
1113548402 13:111173035-111173057 TATTAATGATACAAGTGGAATGG - Intronic
1115207129 14:30920486-30920508 TGGTAGTCATTTAAGTGGCAAGG - Intronic
1115258045 14:31423331-31423353 AAGTAGTTATAAATGTGGAAGGG - Intronic
1115441047 14:33436123-33436145 TCTTAGTCATAGAAGGGGAGTGG + Intronic
1117319663 14:54608778-54608800 TCGTAGATATAGAGGTGGAAGGG + Intronic
1117778912 14:59211837-59211859 TACTAGTCATAGCAGGGGAGAGG - Intronic
1120613475 14:86672764-86672786 TAGTAGAAATAGACATGGAAAGG - Intergenic
1120950150 14:90033395-90033417 TAGTAATTATAGGAGTGCAAAGG - Intronic
1121015284 14:90545337-90545359 TAGTGGTCAGAGAAATGAAAGGG - Intronic
1123929595 15:25157907-25157929 TAGTATTCACTGAAGTTGAATGG + Intergenic
1125176941 15:36833968-36833990 AAGCAGTCATAAAAGTGGTAAGG - Intergenic
1126844428 15:52745771-52745793 TAATAGACAAAGAAGAGGAAAGG - Intergenic
1127473510 15:59311232-59311254 TGACAGTCATAGGAGTGGAACGG + Intronic
1127827992 15:62722595-62722617 TAATAGTCATGCAAGTAGAATGG - Intronic
1128404385 15:67320449-67320471 TAATAGTCATGTAAGTGAAATGG + Intronic
1129345954 15:74919133-74919155 TAGTAGCCATAGGAATGGAAAGG - Intergenic
1130752582 15:86728130-86728152 TAACAGTCATTGAACTGGAAAGG + Intronic
1131243969 15:90774019-90774041 TAGTAGTCCTTGAATTGAAAAGG - Intronic
1133988461 16:10686214-10686236 TGGTATTGATACAAGTGGAAAGG + Intronic
1134390362 16:13814320-13814342 TAGTGGTCAAGGAAGGGGAAGGG + Intergenic
1135232506 16:20722599-20722621 TCATAGAAATAGAAGTGGAAAGG + Intronic
1138255575 16:55556162-55556184 TAGTAATCATACAAGTAAAAAGG - Intronic
1144530494 17:16034091-16034113 AAGTACTCTTAGAAGTGGCATGG + Intronic
1144995236 17:19263516-19263538 TAGAAGTAATATAAGTAGAATGG + Intronic
1145819466 17:27820976-27820998 TAGTAGTTACAGTAGTGGCAGGG + Intronic
1148317581 17:46717058-46717080 CAGTATTCACAGTAGTGGAATGG + Intronic
1156473553 18:37392079-37392101 TCATCGTCACAGAAGTGGAAGGG - Intronic
1156768420 18:40688242-40688264 AAGTAGACATAAAAGTGAAAAGG - Intergenic
1156971161 18:43158248-43158270 TCCTTGTCATAGAAATGGAAAGG - Intergenic
1160162903 18:76488723-76488745 TATTAGTAATAGAACTGTAATGG - Intronic
1160452838 18:78977729-78977751 TAGTAGTAGTAGTAGTGGTAAGG + Intergenic
1161544553 19:4872380-4872402 TAGGAGTCCTAGAATTGGGAGGG - Intergenic
1162037820 19:7951851-7951873 TAGAAGGTACAGAAGTGGAAAGG - Intergenic
1165760443 19:38318266-38318288 TAGTAGTCACACAACTGGTAAGG - Intergenic
1167550285 19:50155622-50155644 TGGTAGCCATGGAAGTGGATTGG - Intronic
925849429 2:8066613-8066635 TGAGAGTCATAGAAGTGGGACGG + Intergenic
926628090 2:15110803-15110825 GAGTAGACTTAAAAGTGGAATGG - Intergenic
928224168 2:29433241-29433263 TAGCATGCATAGAAGTGGACAGG + Intronic
930196639 2:48517131-48517153 GAGTAGTAATAGAAGTGTAGGGG - Intergenic
930794935 2:55379087-55379109 TATTACTCATAAAATTGGAATGG - Intronic
930917139 2:56706667-56706689 AAGTAATAATAGAAGTGGAGAGG + Intergenic
936971580 2:118181476-118181498 TAGTAGTCAGTGAACTGAAATGG + Intergenic
937745762 2:125412436-125412458 TATTAGTCATTAAAATGGAATGG - Intergenic
938250487 2:129812167-129812189 TAGTGTTCATAGAAATGGGAAGG - Intergenic
938640709 2:133275995-133276017 CAGGGGTGATAGAAGTGGAATGG - Intronic
939473590 2:142656742-142656764 AAGTAATCAAAGAAGAGGAAAGG - Intergenic
939671717 2:145020670-145020692 TAGTACTCAAAGAAATGAAATGG + Intergenic
941310374 2:163921413-163921435 TGGGAGTAATAGAAGTAGAAAGG - Intergenic
942861195 2:180614400-180614422 CAGTAATAATAGAAGTGGCATGG - Intergenic
943892228 2:193303549-193303571 TCGAAGTCATATAATTGGAAAGG + Intergenic
944611316 2:201411240-201411262 GAGCAGGCATAGAAGTTGAAAGG - Intronic
944813562 2:203352046-203352068 TAGTCGTTATAGAAGAGCAAAGG + Intronic
1171260604 20:23728609-23728631 TAGCAGTCACAGTAATGGAATGG + Intergenic
1172321036 20:33994972-33994994 CAGTAGCCACAGAAGTGCAAAGG + Intronic
1176785942 21:13255865-13255887 TAGTTGTAATAGAAGTGTAGGGG - Intergenic
1177712693 21:24800120-24800142 TAGTAGTCATAGAAATCTCAAGG - Intergenic
1177909705 21:27016069-27016091 TAGTAGTCATTGCAGTGGTTAGG + Intergenic
1177983963 21:27949564-27949586 TAGTTGTAATAGAAGTGTTAGGG - Intergenic
1182297182 22:29316445-29316467 TAGTAGTGATGGAGGTGGAGTGG - Intronic
1183016658 22:34993978-34994000 TAGTAGTAGTAGTAGTAGAAGGG + Intergenic
1183464536 22:37973110-37973132 CAGGAGTCATAGGAGTGGTAAGG + Exonic
1203298269 22_KI270736v1_random:59166-59188 TAGAATTGAAAGAAGTGGAATGG + Intergenic
951235088 3:20225672-20225694 AAGTAGTCATAAACTTGGAATGG + Intergenic
951975763 3:28506465-28506487 CAGTAGTGAGAGAGGTGGAAGGG + Intronic
954221049 3:49154183-49154205 TAGAAGGCATAGTAGTAGAAGGG + Intergenic
956393224 3:68796941-68796963 TAGTAGTCATTGTAATGAAAGGG - Intronic
956761645 3:72448860-72448882 TGGGAGCCATAGTAGTGGAAAGG + Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957758492 3:84523386-84523408 TATTTCTCATAGAAGAGGAAGGG - Intergenic
957983082 3:87537469-87537491 TAGTAGCCATTTAAATGGAAAGG + Intergenic
958598633 3:96263963-96263985 TAGTAGTTACAGATGTTGAATGG + Intergenic
960543861 3:118889728-118889750 AAGGAGACATAGAGGTGGAAAGG + Intergenic
961742675 3:129043277-129043299 TAGTTGACATACAAGTGAAAGGG + Intergenic
962144242 3:132823257-132823279 TAGTAGTCATAAAAGTAGCTTGG - Intergenic
964490280 3:157228660-157228682 TATTAGACATACAAATGGAAAGG - Intergenic
965449715 3:168822605-168822627 TAGTGGTTATAGAACTGGAGAGG + Intergenic
969386181 4:6850094-6850116 GAGCAGACACAGAAGTGGAAGGG + Intronic
970463986 4:16304796-16304818 TGGGAGTCACAGAAGGGGAAGGG + Intergenic
975185637 4:71399352-71399374 TAGTAGTCATAGAGGTTTATAGG + Intronic
975971719 4:80047464-80047486 CACTATTCATAGAAGTGTAAGGG - Intronic
976964602 4:91021210-91021232 TAGAAGTCATTGAAGAAGAAAGG - Intronic
980947593 4:139338184-139338206 TATTAGTGATAGAAATGGGAGGG + Intronic
981206914 4:142053112-142053134 TATTAGGCAGAGAAGGGGAAAGG + Intronic
982072727 4:151709627-151709649 TGGTAGCCATGGAAATGGAAAGG - Intronic
982362739 4:154538583-154538605 TAGAAGACAGAGAAGAGGAAAGG + Intronic
984465264 4:180092537-180092559 TTTTAGTCACAAAAGTGGAAGGG + Intergenic
994745961 5:103678675-103678697 TATTAGTGGTAGAAGTGCAAAGG + Intergenic
995295036 5:110510488-110510510 TAGTGGCAATAGAAATGGAAAGG - Intronic
997571103 5:134928267-134928289 TAGTATTCCTAGAAGTGAGATGG + Intronic
998058648 5:139101416-139101438 TGGTAGTCATTGAAGTGTTAGGG - Intronic
999131948 5:149290293-149290315 TAGTAGTAATGGAAGAGTAATGG + Intronic
1000427046 5:161103588-161103610 TAGTAATTAAAGGAGTGGAATGG + Intergenic
1003989796 6:11474355-11474377 GTATAGTCATAGAAGTGGAACGG - Intergenic
1004513456 6:16301901-16301923 TAGTAGTCACAGATGTTAAAGGG + Exonic
1005398022 6:25404097-25404119 GAGTAATCTTAGAAGTGGAGGGG - Intronic
1006362994 6:33597864-33597886 TAGGAGTCAGAGAAGTAGGAAGG + Intergenic
1006959378 6:37912635-37912657 AAGAAGTCATATAATTGGAATGG + Intronic
1008420429 6:51292922-51292944 TAGTGGAAAGAGAAGTGGAATGG + Intergenic
1011098343 6:83692813-83692835 TAGTAGGGAAAAAAGTGGAAGGG - Intronic
1012638566 6:101579944-101579966 AAGTAGTCATAAAGTTGGAAAGG - Intronic
1020914354 7:14173688-14173710 TAGTATTCATAGCATTGGTATGG - Intronic
1022194698 7:28053487-28053509 TAATTGTCATAGAATTGGCAAGG - Intronic
1022931883 7:35125913-35125935 TATTAGACATAGAAAGGGAATGG + Intergenic
1023114774 7:36851868-36851890 TAGTAGTAATAGAAATGGGGAGG - Intergenic
1027512485 7:79100197-79100219 TATTAGCCATAGAAGTAGAATGG + Intronic
1028027295 7:85860892-85860914 TATTAGTCATAGAGTTTGAATGG - Intergenic
1030987687 7:116261697-116261719 TTGTAGCCAATGAAGTGGAAAGG - Intergenic
1033999851 7:147399812-147399834 AAGCAATCATAGAACTGGAAGGG + Intronic
1034302803 7:150031319-150031341 CAGTAGTCACAGAAGTGTGAAGG + Intergenic
1035950456 8:4014507-4014529 TAGTAGTCCTTGAAGAGTAAGGG - Intronic
1038605624 8:29000745-29000767 TAGTAGTCACTGGAGGGGAAAGG - Intronic
1040858093 8:51970768-51970790 TTGTAGACTCAGAAGTGGAAGGG - Intergenic
1041737417 8:61126114-61126136 TAGTAGTCACAAGAGTGGCAGGG - Intronic
1042019431 8:64355276-64355298 TAATAGAGATAGAAGTTGAAAGG - Intergenic
1043024631 8:75050273-75050295 TAATAGTCATGAAAGTGGATAGG - Intergenic
1043256260 8:78141053-78141075 TGGAAGACATAGAAGTGAAAAGG - Intergenic
1043540776 8:81259879-81259901 GAGGAGTCATAAAATTGGAAGGG + Intergenic
1044132220 8:88538219-88538241 TGGGAGGCAAAGAAGTGGAAAGG - Intergenic
1044906207 8:97006458-97006480 TAGTATACAAAGAAGTGCAAGGG + Intronic
1046492688 8:114973278-114973300 TAGTGGTCATAGAAGTTGCCTGG - Intergenic
1046686373 8:117232001-117232023 TCATAGTCATAGAATTGGATGGG + Intergenic
1048220341 8:132535148-132535170 TATTTGCCATAGCAGTGGAAGGG + Intergenic
1050405309 9:5303390-5303412 TACTAGTCTAAGAAGTGTAACGG - Intronic
1050408611 9:5338556-5338578 TACTAGTCTAAGAAGTGTAACGG - Intronic
1050662006 9:7892955-7892977 AAATAGTCACAGAAGTGAAACGG + Intergenic
1051294369 9:15579642-15579664 TAGTAGTCATCCATGTAGAAGGG - Intronic
1051809605 9:21033732-21033754 TAGTATTCATAAAAGAAGAAAGG - Intergenic
1052300335 9:26946749-26946771 TAATAGTCTGAGAATTGGAAGGG + Intronic
1052655261 9:31350510-31350532 TAGGAGGCATAAAAGAGGAAAGG + Intergenic
1055143312 9:72901804-72901826 TGATTGTCATAGAAGTGGTAAGG + Intronic
1057967641 9:99519546-99519568 TAGTATTCATATAAGTGGTCGGG - Intergenic
1202630238 M:10507-10529 TAGTATTCCTAGAAGTGAGATGG - Intergenic
1186565412 X:10656935-10656957 TACTGGGCATAGAAATGGAAAGG - Intronic
1186578736 X:10793996-10794018 TAGTGGACAGAGAAGTGGCAGGG - Intronic
1186838653 X:13463340-13463362 TAGGAGTCATAGAACTGGGAGGG - Intergenic
1187853949 X:23618761-23618783 AAGCAGTCATATATGTGGAAGGG + Intergenic
1187948616 X:24450643-24450665 TTGTAGACCTAGAAGTGGAATGG - Intergenic
1189173709 X:38933526-38933548 TAATAGAGATAGAAGTGGCAAGG + Intergenic
1190816137 X:53931473-53931495 TAGTAGGGAGAGAGGTGGAAGGG + Intergenic
1193087199 X:77457453-77457475 TTAAAGTCATAGAACTGGAAAGG - Intergenic
1194033737 X:88845985-88846007 TAGTAGTAATAGTAGACGAATGG - Intergenic
1196189921 X:112783342-112783364 TAGAAGTCATAGAGGGGGAAAGG + Intronic
1196458232 X:115904662-115904684 TAGAAGTCAAAGAAATGGAAAGG - Intergenic
1198166880 X:134066552-134066574 GAGTTGTCGTAGAAATGGAAAGG + Intergenic
1199281038 X:145999512-145999534 TTGTAATCATACAACTGGAATGG + Intergenic
1200691860 Y:6313648-6313670 TAGAAGTCATTGAAGTAGATAGG + Intergenic
1200832243 Y:7698082-7698104 TAGAAGTCATTGAAGTAGATAGG + Intergenic
1201043412 Y:9861075-9861097 TAGAAGTCATTGAAGTAGATAGG - Intergenic
1201122291 Y:10882369-10882391 TAGAATGCAAAGAAGTGGAATGG - Intergenic