ID: 1068901839

View in Genome Browser
Species Human (GRCh38)
Location 10:62278172-62278194
Sequence TCTGGAAAGTTGCCTGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068901839_1068901842 2 Left 1068901839 10:62278172-62278194 CCAGTGACAGGCAACTTTCCAGA No data
Right 1068901842 10:62278197-62278219 GTAGATGGTATAATATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068901839 Original CRISPR TCTGGAAAGTTGCCTGTCAC TGG (reversed) Intergenic
No off target data available for this crispr