ID: 1068901857

View in Genome Browser
Species Human (GRCh38)
Location 10:62278530-62278552
Sequence CCTATGAAGCAGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068901857_1068901863 24 Left 1068901857 10:62278530-62278552 CCTTCCTCTGTCTGCTTCATAGG No data
Right 1068901863 10:62278577-62278599 TGAAAGTATTTGAAAAATGTAGG No data
1068901857_1068901864 25 Left 1068901857 10:62278530-62278552 CCTTCCTCTGTCTGCTTCATAGG No data
Right 1068901864 10:62278578-62278600 GAAAGTATTTGAAAAATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068901857 Original CRISPR CCTATGAAGCAGACAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr