ID: 1068903734

View in Genome Browser
Species Human (GRCh38)
Location 10:62299392-62299414
Sequence GACTCACTCCCTTCTCCTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068903734_1068903738 -2 Left 1068903734 10:62299392-62299414 CCCGTAGGAGAAGGGAGTGAGTC No data
Right 1068903738 10:62299413-62299435 TCATGCCAGTATCTGGAGGCTGG No data
1068903734_1068903742 24 Left 1068903734 10:62299392-62299414 CCCGTAGGAGAAGGGAGTGAGTC No data
Right 1068903742 10:62299439-62299461 GCCTTGAGGAAAAGTCAGCCTGG No data
1068903734_1068903736 -9 Left 1068903734 10:62299392-62299414 CCCGTAGGAGAAGGGAGTGAGTC No data
Right 1068903736 10:62299406-62299428 GAGTGAGTCATGCCAGTATCTGG No data
1068903734_1068903744 25 Left 1068903734 10:62299392-62299414 CCCGTAGGAGAAGGGAGTGAGTC No data
Right 1068903744 10:62299440-62299462 CCTTGAGGAAAAGTCAGCCTGGG No data
1068903734_1068903737 -6 Left 1068903734 10:62299392-62299414 CCCGTAGGAGAAGGGAGTGAGTC No data
Right 1068903737 10:62299409-62299431 TGAGTCATGCCAGTATCTGGAGG No data
1068903734_1068903739 2 Left 1068903734 10:62299392-62299414 CCCGTAGGAGAAGGGAGTGAGTC No data
Right 1068903739 10:62299417-62299439 GCCAGTATCTGGAGGCTGGAAGG No data
1068903734_1068903741 10 Left 1068903734 10:62299392-62299414 CCCGTAGGAGAAGGGAGTGAGTC No data
Right 1068903741 10:62299425-62299447 CTGGAGGCTGGAAGGCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068903734 Original CRISPR GACTCACTCCCTTCTCCTAC GGG (reversed) Intergenic
No off target data available for this crispr