ID: 1068906027

View in Genome Browser
Species Human (GRCh38)
Location 10:62323764-62323786
Sequence AAGCATGTCATCTGCAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16186
Summary {0: 23, 1: 6499, 2: 5330, 3: 2353, 4: 1981}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068906027_1068906031 26 Left 1068906027 10:62323764-62323786 CCCTGTTTGCAGATGACATGCTT 0: 23
1: 6499
2: 5330
3: 2353
4: 1981
Right 1068906031 10:62323813-62323835 AGCCCGAAAGCTCCTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068906027 Original CRISPR AAGCATGTCATCTGCAAACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr