ID: 1068906028

View in Genome Browser
Species Human (GRCh38)
Location 10:62323765-62323787
Sequence GAAGCATGTCATCTGCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068906028_1068906031 25 Left 1068906028 10:62323765-62323787 CCTGTTTGCAGATGACATGCTTC No data
Right 1068906031 10:62323813-62323835 AGCCCGAAAGCTCCTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068906028 Original CRISPR GAAGCATGTCATCTGCAAAC AGG (reversed) Intergenic
No off target data available for this crispr