ID: 1068906031

View in Genome Browser
Species Human (GRCh38)
Location 10:62323813-62323835
Sequence AGCCCGAAAGCTCCTTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068906027_1068906031 26 Left 1068906027 10:62323764-62323786 CCCTGTTTGCAGATGACATGCTT 0: 23
1: 6499
2: 5330
3: 2353
4: 1981
Right 1068906031 10:62323813-62323835 AGCCCGAAAGCTCCTTCAGCTGG No data
1068906028_1068906031 25 Left 1068906028 10:62323765-62323787 CCTGTTTGCAGATGACATGCTTC No data
Right 1068906031 10:62323813-62323835 AGCCCGAAAGCTCCTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068906031 Original CRISPR AGCCCGAAAGCTCCTTCAGC TGG Intergenic
No off target data available for this crispr