ID: 1068908913

View in Genome Browser
Species Human (GRCh38)
Location 10:62357692-62357714
Sequence TACAGCTGTCCCTTTTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068908913_1068908920 18 Left 1068908913 10:62357692-62357714 CCACCTGAAAAGGGACAGCTGTA No data
Right 1068908920 10:62357733-62357755 GGGACATCTCTGAAGAAAAGTGG No data
1068908913_1068908915 -3 Left 1068908913 10:62357692-62357714 CCACCTGAAAAGGGACAGCTGTA No data
Right 1068908915 10:62357712-62357734 GTAGCATTACATCCCCTCTCTGG No data
1068908913_1068908916 -2 Left 1068908913 10:62357692-62357714 CCACCTGAAAAGGGACAGCTGTA No data
Right 1068908916 10:62357713-62357735 TAGCATTACATCCCCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068908913 Original CRISPR TACAGCTGTCCCTTTTCAGG TGG (reversed) Intergenic
No off target data available for this crispr