ID: 1068910478

View in Genome Browser
Species Human (GRCh38)
Location 10:62374243-62374265
Sequence ACCGTGGGGCACCGCGCCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068910478_1068910491 26 Left 1068910478 10:62374243-62374265 CCCACGGCGCGGTGCCCCACGGT 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1068910491 10:62374292-62374314 AGCCGCGCCTCGCTCCGCCCTGG 0: 1
1: 0
2: 0
3: 21
4: 182
1068910478_1068910484 1 Left 1068910478 10:62374243-62374265 CCCACGGCGCGGTGCCCCACGGT 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1068910484 10:62374267-62374289 CCCGCGAGCGCCGCCCCCGCTGG 0: 1
1: 0
2: 1
3: 30
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068910478 Original CRISPR ACCGTGGGGCACCGCGCCGT GGG (reversed) Exonic
900609260 1:3537547-3537569 GCCGGGGGGCACCGGGCCCTGGG + Intronic
901636840 1:10674456-10674478 ACCGTGGGGCACCTGGGCTTTGG + Intronic
1068910478 10:62374243-62374265 ACCGTGGGGCACCGCGCCGTGGG - Exonic
1078246090 11:9574120-9574142 TCCGTGGGGCTCCGCGCGGGCGG - Exonic
1083417486 11:62535097-62535119 ACCATGGGGCACCACACGGTGGG - Exonic
1095423463 12:42049477-42049499 ACAGTGGTGCAGCGCACCGTGGG - Intergenic
1097189026 12:57210723-57210745 CCCGTGGGGCACCGGCACGTGGG - Exonic
1105070650 12:133232475-133232497 AGAGTGGGGCACAGAGCCGTCGG - Intronic
1108627811 13:52248495-52248517 ACTGTGAGGCACCGCCCGGTAGG - Intergenic
1108658251 13:52557958-52557980 ACTGTGAGGCACCGCCCAGTAGG + Intergenic
1128561142 15:68668598-68668620 ACCCTGGGGCTCCCCGCCCTGGG - Intronic
1136222244 16:28836039-28836061 ACTCTGGGGCACCGCGCCTTGGG - Exonic
1139215341 16:65121466-65121488 GCTGGCGGGCACCGCGCCGTGGG + Intronic
1141647187 16:85373818-85373840 ACCGTGGGGCACCGTGGGGCAGG - Intergenic
1142347178 16:89561291-89561313 ACCGTGGGGCAGCGCACGATGGG - Exonic
1151703144 17:75753879-75753901 CCCGTGGGGCGCCTCGGCGTCGG - Exonic
1152575853 17:81140714-81140736 ACCGTGGGGCTGTGAGCCGTGGG + Intronic
1152575864 17:81140745-81140767 ACCGTGGGGCCGTGAGCCGTGGG + Intronic
1152575882 17:81140800-81140822 ACCGTGGGGCTGTGAGCCGTGGG + Intronic
1152575893 17:81140831-81140853 ACCGTGGGGCCGTGAGCCGTGGG + Intronic
1160913112 19:1483836-1483858 ACCTTGGCGCCCCACGCCGTTGG + Exonic
1161307477 19:3576050-3576072 TCCGTGGGGCACAGTCCCGTGGG + Intronic
1162685160 19:12376839-12376861 GCCACGGGGCACCGCGCCTTGGG - Intergenic
1168423025 19:56217591-56217613 ACCGTGGGGCAGCGCACGATGGG + Intergenic
926801759 2:16665680-16665702 ACCGCGGGGCACCGCGAGGCGGG - Intronic
1175811744 20:61862062-61862084 AGCGTGGGGGACAGCGCCCTGGG - Intronic
953485120 3:43287054-43287076 CCCGCGGGGCCCCGCGCCCTGGG + Intronic
957867989 3:86049790-86049812 ACGGTTTGGCACCGCCCCGTTGG - Intronic
984928530 4:184826599-184826621 GCCGTGGTGCAGCGCGCAGTCGG - Exonic
1002024554 5:176388244-176388266 ACGGAGGGGCACCGCCCTGTTGG + Exonic
1006637137 6:35468884-35468906 ACCCTGGGGCACGGCGCGGGTGG + Intronic
1007383231 6:41503921-41503943 GCCGTGGGGCTGCGCGCCGCTGG + Intergenic
1007902092 6:45422207-45422229 CCCTTGGGGCACCGCGTCCTGGG - Intronic
1035605506 8:927615-927637 ATCGTGGGGCCCAGCACCGTGGG + Intergenic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1043472676 8:80578285-80578307 CCCGTGGGACACCGGGCCCTAGG - Intergenic
1055757709 9:79572993-79573015 TCCGAGGGCCACCGCGCCGGGGG - Intronic
1197732571 X:129823809-129823831 GCCCTGGGGCACCGCACCATTGG + Exonic
1200648781 Y:5816314-5816336 GCCGTGGGGCAGCCCACCGTTGG + Intergenic