ID: 1068911706

View in Genome Browser
Species Human (GRCh38)
Location 10:62385211-62385233
Sequence TTAGGTTAGCAGTTTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068911703_1068911706 10 Left 1068911703 10:62385178-62385200 CCCTAGTTGATGTAATACATCTA 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1068911706 10:62385211-62385233 TTAGGTTAGCAGTTTGTGCCAGG No data
1068911702_1068911706 13 Left 1068911702 10:62385175-62385197 CCACCCTAGTTGATGTAATACAT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1068911706 10:62385211-62385233 TTAGGTTAGCAGTTTGTGCCAGG No data
1068911704_1068911706 9 Left 1068911704 10:62385179-62385201 CCTAGTTGATGTAATACATCTAC 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1068911706 10:62385211-62385233 TTAGGTTAGCAGTTTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068911706 Original CRISPR TTAGGTTAGCAGTTTGTGCC AGG Intronic
No off target data available for this crispr